doi: 10.15389/agrobiology.2023.4.669rus

УДК 636.5.033:591.1:571.27

Исследования проведены при финансовой поддержке Российского научного фонда по проекту 22-16-00024.

БИОХИМИЧЕСКИЕ И МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ ИНДИКАТОРЫ АНТИОКСИДАНТНОЙ ЗАЩИТЫ И ИММУНИТЕТА У ПЕТУШКОВ (Gallus gallus domesticus) РАЗНЫХ ГЕНОТИПОВ

Н.В. БОГОЛЮБОВА ✉, Р.В. НЕКРАСОВ, Д.А. НИКАНОВА,
А.А. ЗЕЛЕНЧЕНКОВА, Н.С. КОЛЕСНИК, Р.А. РЫКОВ, Н.А. ВОЛКОВА,
А.Н. ВЕТОХ, Л.А. ИЛЬИНА

Сравнительное изучение взаимосвязи процессов антиоксидантной защиты (АОЗ) и иммунитета в организме сельскохозяйственной птицы различных генотипов актуально при клинико-физиологической оценке состояния здоровья и поиске сочетаний генотипов для получения новых кроссов. В настоящей работе впервые установлены различия в биохимических и молекулярно-генетических индикаторах антиоксидантной защиты и иммунитета у петушков (Gallus gallus domesticus) пород русская белая, кросса Ross 308 и помесей пород русская белая и корниш. Описаны корреляции между экспрессией некоторых генов ферментов АОЗ и иммунитета в слепых отростках кишечника, тканях печени и среднесуточным приростом живой массы, а также между относительной экспрессией разных генов петушков. Целью работы было изучение факторов формирования иммунитета и антиоксидантного статуса, показателей неспецифического иммунитета, экспрессии генов ферментов, участвующих в антиоксидантной защите и развитии иммунного ответа, у петушков (Gallus gallus domesticus) разных генотипов.Исследования проводили в условиях физиологического двора ФИЦ животноводства — ВИЖ им. академика Л.К. Эрнста в 2022 году. Образцы крови отбирали при убое в возрасте 9 нед у петушков русской белой породы (RW, n = 28), бройлеров кросса Ross 308 (n = 9) и помесей пород русская белая и корниш (CORN × RW, n = 128). Определяли концентрацию продуктов, реагирующих с тиобарбитуровой кислотой (ТБК-АП), с использованием наборов «Агат-Мед» (Россия), активность церулоплазмина (ЦП) по методу Ревина, суммарное содержание водорастворимых антиоксидантов (СКВА) — амперометрическим методом на приборе ЦветЯуза-01-АА с амперометрическим детектором («Химавтоматика», Россия), соотношение ТБК-АП к ЦП — расчетным методом. СКВА оценивали эквивалентно галловой кислоте. Для этого из раствора галловой кислоты (100 мг/дм3) готовили рабочие растворы для градуировки с массовой концентрацией 0,2; 0,5; 1,0 и 4,0 мг/дм3. Элюентом служил раствор ортофосфорной кислоты (0,0022 моль/дм3). Остальные показатели антиоксидантного статуса — содержание глутатиона восстановленного (E-BC-K096-M), активность супероксиддисмутазы (СОД) (E-BC-K020-M), каталазы (E-BC-K031-M) и общий антиоксидантный статус (ОАС) (E-BC-K219-M) — определяли ИФА-методом с использованием микропланшетного фотометра Immunochem-2100 («High Technology, Inc.», США) и коммерческих наборов («Elabscience Biotechnology, Inc.», Китай) согласно протоколам, предложенным производителем. Показатели неспецифического иммунитета петушков RW (n = 12), CORN × RW (n = 68) и Ross 308 (n = 9) — бактерицидную (БАСК) и лизоцимную активность (ЛАСК) определяли с использованием микробиологического анализатора Multiskan FC («ThermoFisher Scientific, Inc.», Финляндия). Анализ относительной экспрессии генов проводили при помощи ПЦР в реальном времени. Для этого у петушков RW (n = 10), Ross 308 (n = 9) и CORN × RW (n = 11) отбирали образцы тканей слепых отростков кишечника и печени (всего 30 образцов каждой ткани). Определяли относительную экспрессию генов, отвечающих за антиоксидантную защиту (каталазы — CAT,глутатионпероксидазы — GSH-Gpx, гемоксигеназы 1 — HO-1, супероксиддисмутазы — SOD, родственного фактора транскрипции 2 NF-E2 — Nrf2) иучаствующих в развитии иммунного ответа (птичий бета-дефензин 9 — AvBD9, интерлейкин 6 — IL6, интерлейкин 8 — IL8). ОАС у бройлеров был ниже, чем у аналогов, что подтверждалось максимальным содержанием ТБК-АП — 4,27 против 3,04 мкмоль/л у RW (р < 0,05) и 2,79 мкмоль/л (р < 0,01) у CORN × RW, минимальным содержанием церулоплазмина (37,78 мг/л) и, соответственно, более высоким соотношением ТБК-АП/ЦП. При этом в крови петушков кросса Ross 308 наблюдалось максимальное СКВА (49,78 мг/л при р < 0,001 по сравнению с RW), что было обусловлено наибольшим среди аналогов количеством восстановленного глутатиона (38,26 мкмоль/л при р < 0,001 по сравнению с RW и р < 0,001 по сравнению с CORN × RW). Несмотря на это, а также на высокую активность каталазы в крови бройлеров (100,50 Ед/л при р < 0,05 по сравнению с RW и р < 0,01 по сравнению с CORN × RW), от их антиоксидантной системы требовалось наибольшее напряжение для нейтрализации активных форм кислорода (АФК). Изучение относительной экспрессии генов АОЗ и иммунитета подтвердило полученные данные. Так, в слепых отростках кишечника бройлеров относительная экспрессия генов CAT и GSH-Gpx была в 5 раз выше по сравнению с группой RW (соответственно р = 0,0007 и р = 0,0008), HO-1 — в 2 раза (р =0 ,01), SOD — на 40 %. В печени бройлеров наблюдалось снижение относительной экспрессии генов SOD и GSH-Gpx в 5-6 раз по сравнению с RW (р = 0,005 для обоих генов), экспрессия САТ возросла на 27 %, НО-1 — в 42 раза (р = 0,001). У бройлеров наиболее высокими были показатели содержания и активности лизоцима в сыворотке крови (0,47 мкг/мл и 3,14 AU/TP, p < 0,001) при снижении процента лизиса (36,1 против 45,6-48,7 % у остальных петушков, p < 0,05) при минимальной среди аналогов БАСК. Подтверждением служит тот факт, что экспрессия провоспалительных цитокинов (в первую очередь IL-8), ингибирующих гуморальный иммунитет, в исследуемых тканях бройлеров была в целом ниже, а у петушков других генотипов повышалась. Это и могло стимулировать снижение гуморального ответа. Среднесуточный прирост живой массы птицы в очень высокой степени коррелировал с экспрессией в слепых отростках кишечника CAT (r = 0,998 при р = 0,03) и AvBD-9 (r = 0,999 при р = 0,016). В слепых отростках обнаружены корреляции высокой степени между экспрессией CAT и AvBD-9 (r = 0,999 при р = 0,014), IL6 и HO-1 (r = 0,999 при р = 0,1), что подтверждает связь между АОЗ и здоровьем птицы. У бройлеров кросса Ross 308 отмечалось более высокое накопление продуктов перекисного окисления липидов, что подчеркивает целесообразность снижения окислительного стресса за счет алиментарных факторов и создания дополнительной защиты для антиоксидантной системы птицы с целью повышения качества птицеводческой продукции.

Ключевые слова: антиоксидантный статус, иммунитет, куры, бройлеры, генотипы, экспрессия генов, CAT, GSH-Gpx, HO-1, SOD, Nrf2, AvBD9, IL6, IL8.

Птица современных генотипов имеет высокий потенциал продуктивности, но зачастую он реализуется не в полной мере по причине воздействия на организм стрессов различной этиологии. Окислительный стресс, который становится результатом дисбаланса образования и детоксикации свободных радикалов в результате нарушения кормовых, климатических, технологических и биологических условий выращивания, негативно отражается на состоянии здоровья, показателях роста и качестве продукции. Влияние на организм птицы различных стрессов описаны нами в предыдущей работе (1). Установлено, что климатические и другие факторы содержания определяют поведенческие, физиологические и иммунные реакции в организме, влияют на антиоксидантный и биохимический статус, продуктивность. Изучению влияния стрессов различной этиологии, в том числе окислительного, на организм птицы и качество продукции посвящены работы разных авторов (2-5). Доказано, что окислительный стресс может ухудшить состояние здоровья, показатели роста и качество мяса (6-9).

Активные формы кислорода (АФК) образуются в митохондриях (10). При нормальных физиологических процессах в организме продукция и клиренс АФК находятся в состоянии динамического равновесия (11). Однако при сдвиге этого равновесия АФК могут приводить к окислительному повреждению, патологическим процессам и даже гибели клеток (12). Окислительный стресс индуцирует чувствительность к АФК, передачу сигналов по определенным путям и активацию генов-мишеней, например тех, которые кодируют антиоксидантную защиту и некоторые медиаторы воспаления.

Существует взаимосвязь между антиоксидантными системами защиты и естественной резистентностью организма. Так, усиление свободнорадикальных реакций перекисного окисления липидов (ПОЛ) приводит к нарушению функции переработки антигенной информации и синтеза антител. Повреждая клеточные структуры, окислительный стресс может запускать или усиливать воспалительную реакцию, вызванную иммунными клетками и медиаторами (13). В то же время ряд иммуномодуляторов блокирует ПОЛ плазматических и субклеточных мембран, предохраняя их от действия перекисей и свободных радикалов, образующихся особенно часто в метаболически активных клетках (макрофаги, нейтрофилы), и тем самым сохраняя нормальную структуру и функцию мембран (14).

В организме присутствуют разнообразные антиоксидантные молекулы, противодействующие АФК и нейтрализующие их и другие окислители. Системы антиоксидантной защиты можно разделить на две категории — ферментативные и неферментативные. Они также могут быть классифицированы как эндогенно продуцируемые или экзогенные пищевые антиоксиданты (15).

Известно, что на состояние антиоксидантной защиты и иммунитета влияют экзо- и эндогенные факторы. Особенности физиолого-биохимических процессов в организме, которые определяют интенсивность метаболизма и скорость роста птицы, в значительной степени зависят от ее происхождения и направления продуктивности (16). Ряд авторов связывают антиоксидантные свойства птицеводческой продукции с породой птицы (17, 18). При этом мало известно о влиянии генотипа на антиоксидантную защиту у птицы. Интерес представляет сравнительное изучение взаимосвязи процессов антиоксидантной защиты и иммунитета у птицы разных генотипов, что актуально при клинико-физиологической оценке состояния здоровья и поиске сочетаний генотипов для получения новых кроссов. Комплексный подход, включающий биохимические, микробиологические и молекулярно-генетические методы, дает более глубокое понимание механизмов формирования иммунитета и антиоксидантной защиты, что необходимо для получения качественной продукции птицеводства.

В настоящей работе впервые установлены различия в биохимических и молекулярно-генетических индикаторах антиоксидантной защиты и иммунитета у петушков пород русская белая, кросса Ross 308 и помесей пород русская белая и корниш. Выявлены корреляции между экспрессией некоторых генов ферментов АОЗ и иммунитета в слепых отростках кишечника, тканях печени и среднесуточным приростом живой массы, а также между относительной экспрессией генов.

Целью работы было изучение факторов формирования иммунитета и антиоксидантного статуса, показателей неспецифического иммунитета, экспрессии генов ферментов, участвующих в антиоксидантной защите и развитии иммунного ответа, у петушков (Gallus gallus domesticus) разных генотипов.

Методика. Исследования проводили в условиях физиологического двора ФИЦ животноводства — ВИЖ им. академика Л.К. Эрнста в 2022 году. Для биохимической оценки про- и антиоксидантного статуса были проанализированы пробы крови, отобранные при убое в возрасте 9 нед у петушков (Gallus gallus domesticus) русской белой породы (RW, n = 28), бройлеров кросса Ross 308 (n = 9) и помесей пород русская белая и корниш (CORN × RW, n = 128). Птицу содержали в одинаковых условиях физиологического двора.

В сыворотке крови определяли концентрацию продуктов, реагирующих с тиобарбитуровой кислотой (ТБК-АП) с использованием наборов «Агат-Мед» (Россия), активность церулоплазмина (ЦП) по методу Ревина (19), суммарное содержание водорастворимых антиоксидантов (СКВА) — амперометрическим методом на приборе ЦветЯуза-01-АА с амперометрическим детектором («Химавтоматика», Россия), соотношение ТБК-АП к ЦП — расчетным методом.

Для определения СКВА измеряли силу электрического тока, возникающего при окислении молекул на поверхности электрода при определенном потенциале. СКВА оценивали эквивалентно галловой кислоте. Для этого из раствора галловой кислоты (100 мг/дм3) готовили рабочие растворы для градуировки с массовой концентрацией 0,2; 0,5; 1,0 и 4,0 мг/дм3. В качестве элюента использовали раствор ортофосфорной кислоты (0,0022 моль/дм3). Остальные показатели антиоксидантного статуса — содержание глутатиона восстановленного (E-BC-K096-M), активность супероксиддисмутазы (СОД) (E-BC-K020-M), каталазы (E-BC-K031-M) и общий антиоксидантный статус (ОАС) (E-BC-K219-M) определяли ИФА-методом с использованием мик-ропланшетного фотометра Immunochem-2100 («High Technology, Inc.», США) и коммерческих наборов («Elabscience Biotechnology, Inc.», Китай) согласно протоколам, предложенным производителем.

Показатели неспецифического иммунитета петушков RW (n = 12), CORN × RW (n = 68) и Ross 308 (n = 9) — бактерицидную (БАСК) и лизоцимнную активность (ЛАСК) определяли с использованием микробиологического анализатора Multiskan FC («ThermoFisher Scientific, Inc.», Финляндия) (20). Лизоцимная активность сыворотки крови (ЛA) характеризовалась процентом лизиса, количеством лизоцима в 1 мл сыворотки крови (лизоцим, мкг/мл) и удельными единицами активности (УA) в пересчете на 1 мг белка (AU/TP) (21).

Анализ относительной экспрессии генов проводили при помощи ПЦР в реальном времени. Для этого у петушков RW (n = 10), Ross 308 (n = 9) и CORN × RW (n = 11) отобрали образцы тканей слепых отростков и печени (всего 30 образцов каждой ткани). Определяли относительную экспрессию генов, отвечающих за антиоксидантную защиту (каталазы — CAT,глутатионпероксидазы — GSH-Gpx, гемоксигеназы 1 — HO-1, супероксиддисмутазы — SOD, родственного фактора транскрипции 2 NF-E2 — Nrf2) и участвующих в развитии иммунного ответа (птичий бета-дефензин 9 — AvBD9,интерлейкин6— IL6,интерлейкин 8 — IL8).Подготовку образцов осуществляли согласно «Инструкции по санитарно-микробиологическому контролю тушек, мяса птицы, птицепродуктов, яиц и яйцепродуктов на птицеводческих и перерабатывающих предприятиях» (https://mega-norm.ru/Data2/1/4293751/4293751517.pdf). Образцы помещали в раствор IntactRNA («Евроген», Россия) и хранили при -20 °С. Исследования проводили в 3-кратной повторности.

Тотальную РНК из образцов выделяли с помощью набора Aurum Total RNA («Bio-Rad», США) согласно инструкции производителя. Гомогенизацию образцов осуществляли на гомогенизаторе Precellys Evolution («Bertin Technologies SAS», Франция). При помощи набора iScript™ RT Supermix («Bio-Rad», США) проводили реакцию обратной транскрипции для получения кДНК на матрице РНК.

Амплификацию проводили с использованием SsoAdvanced™ Universal SYBR→ Green Supermix («Bio-Rad», США) в соответствии с протоколом производителя (22) на амплификаторе детектирующем ДТлайт (НПО «ДНК-Технология», Россия). Режим и условия амплификации: 5 мин при 95 °C (предварительный денатурация); 30 с при 95 °C, 30 с при 60 °C, 30 с при 70 °C (40 циклов) (23). Относительную экспрессию рассчитывали методом 2-∆∆Ct (24). В качестве референсного гена был выбран ген белка бета-актина ACTB птицы. Последовательности праймеров (5´ → 3´) были следующими: SOD — F: CGGGCCAGTAAAGGTTACTGGAA, R: TGTT-GTCTCCAAATTCATGCACATG; GSH-Px — F: GCATCCGCTTCCACGAC-TTCCT, R: CCGCTCATCCGGGTCCAACAT; HO-1 — F: GGTCCCGAAT-GAATGCCCTTG, R: ACCGTTCTCCTGGCTCTTGG, CAT — F: ACCAAG-TACTGCAAGGCGAA, R: TGAGGGTTCCTCTTCTGGCT; Nrf2 — F: AAAA-CGCTGAACCACCAATC, R: GCTGGAGAAGCCTCATTGTC; AvBD-9 — F: AACACCGTCAGGCATCTTCACA, R: CGTCTTCTTGGCTGTAAGCTGGA; IL6 — F: AGGACGAGATGTGCAAGAAGTTC, R: TTGGGCAGGTTGAG-GTTGTT; IL8 — F: GGAAGAGAGGTGTGCTTGGA, R: TAACATGAGG-CACCGATGTG.

Среднесуточный прирост живой массы определяли взвешиванием, которое выполняли строго до кормления птицы. Использовали аналитические весы PR224 («Ohaus Corp.», США) для 1-суточных цыплят, весы кухонные электронные VT-8008 («Vitek», Россия) для цыплят в возрасте от 1 сут до 3-4 нед и электронный безмен MT-1645 («MARTA», Китай) для взрослых особей.

Математическую обработку результатов проводили в программных пакетах Microsoft Office Excel 2003, STATISTICA 10 (Statistica 13RU, «Stat-Soft, Inc.», США) с использованием методов описательной статистики и корреляционного анализа. Рассчитывали средние значения (M), стандартные ошибки средних (±SEM), стандартные отклонения (±SD), коэффициенты вариации (Cv), коэффициенты корреляции по Пирсону (r). Корреляции c r до 0,2 считали очень слабыми, 0,2-0,5 — слабыми, 0,5-0,7 — средними, 0,7-0,9 — высокими, больше 0,9 — очень высокими. При Cv < 10 % разброс значений данных считали незначительным, при Cv = 10-20 % — средним, при 20 % < Cv ≤ 33 % — значительным. Различия были статистически значимыми при р < 0,05, высокодостоверными — при р < 0,01; р < 0,001.

Результаты. Интенсивность ПОЛ обусловлена, с одной стороны, процессами радикало- и перекисеобразования, с другой — состоянием эндогенных систем антиоксидантной защиты, поэтому определение антиокислительной активности этих систем имеет практическое значение (25). Зачастую для оценки состояния ПОЛ широко используется реакция с тиобарбитуровой кислотой (ТБК). ТБК-тест основан на способности ТБК реагировать с малоновым диальдегидом (МДА), который представляет собой низкомолекулярное соединение и служит промежуточным продуктом энзиматического окисления арахидоновой кислоты и конечным продуктом окислительной деградации липидов (26, 27).

Продукты ПОЛ, в частности МДА, проявляют цитотоксические, мутагенные и канцерогенные свойства. Последствиями их воздействия становятся, например, потеря потенциала распространения клеток, изменение экспрессии генов, мутации, молекулярная гетерогенность, нарушение межклеточной коммуникации и органная дисфункция (28). Кроме того, МДА —один из конечных продуктов перекисного окисления полиненасыщенных жирных кислот в организме человека и маркер окислительного стресса.

В нашем исследовании максимальное содержание ТБК-АП в сыворотке крови было у бройлеров: 4,27 мкмоль/л против 3,04 мкмоль/л у петушков RW (р < 0,05) и 2,79 мкмоль/л — у CORN × RW (р < 0,01) (табл. 1).

Внимание к церулоплазмину обусловлено тем, что это один из основных гасителей внеклеточных свободных радикалов. Показано, что церулоплазмин специфически ингибирует повреждения различных биомолекул (29). Содержание церулоплазмина в сыворотке крови у птицы RW составляло 62,53 мг/л, у помесей CORN × RW — 41,94 мг/л, у бройлеров — 37,78 мг/л. Разница оказалась статистически значимой между группами RW и бройлерами (р < 0,001), а также между RW и CORN × RW (р < 0,01).

СКВА в крови у птиц колебалось в пределах 45,20-49,78 мг/л с максимальным показателем у бройлеров (достоверная разница с CORN × RW при р < 0,001). У этих особей показатель имел низкую степень изменчивости. У петушков RW СКВА составило 45,20 мг/л и характеризовалось средней степенью изменчивости. Минимальное СКВА отмечали у CORN × RW (41,03 мг/л) при высокой степени изменчивости. Максимальное СКВА в крови бройлеров по сравнению с особями других генотипов, скорее всего, было связано с повышением количества восстановленного глутатиона и другими водорастворимыми антиоксидантами, содержание которых мы не учитывали.

Количество восстановленного глутатиона и активность каталазы у бройлеров были наибольшими среди анализируемых генотипов — соответственно 38,26 мкмоль/л (при р < 0,001 по сравнению с RW и р < 0,001 — по сравнению с помесями) и 100,50 Ед/л (при р < 0,05 и р < 0,01). Активность СОД, напротив, оказалась минимальной — 15,22 Ед/мл (при р < 0,001 по сравнению с RW и р < 0,001 — по сравнению с помесями). При этом ОАС у бройлеров был ниже, чем у аналогов, что можно объяснить большим расходом различных антиоксидантов для взаимодействия с продуктами ПОЛ — ТБК-АП. При оценке сопряженности процессов липопероксидации и антиоксидантной защиты (АОЗ) на основе расчета соотношения ряда компонентов этих систем, мы отмечали, что отношение ТБК-АП/ЦП у бройлеров из-за низкой активности ЦП было выше, чем у птиц других генотипов. То есть антиоксидантная система у бройлеров кросса Ross 308 наиболее уязвима, несмотря на высокий показатель СКВА и активность каталазы. Этот факт подтверждается минимальным показателем ОАС, который характеризует состояние всех антиоксидантов в организме (30).

Таким образом, высокая скорость роста бройлеров делает их более подверженными окислительному стрессу, что может негативно отражаться на качестве мяса. По данным И.Ф. Горлова с соавт. (31), степень окислительных изменений в охлажденном мясе зависит от реактивности антиоксидантной системы птицы и образования продуктов ПОЛ. Ослабление антиоксидантной активности и активация свободнорадикального окисления липидов в плазме крови цыплят-бройлеров усиливают процессы окисления мяса (31). Кроме того, при стрессе увеличивается образование свободных радикалов, которые могут инактивировать важнейшие антиоксидантные ферменты, вызывая автокаталитическое необратимое окисление (32). В связи с этим синтез новых антиоксидантных ферментов служит важнейшей реакцией на стрессовые состояния, чем можно объяснить более высокую активности каталазы, содержание восстановленного глутатиона и СКВА у бройлеров.

M. Madkour с соавт. (33) отмечали снижение активности каталазы и супероксиддисмутазы в тканях печени бройлеров при тепловом стрессе в раннем возрасте по сравнению с птицей, выращенной в обычных условиях.

К.С. Остренко с соавт. (34) предлагают восполнять потребность кур-несушек в антиоксидантах при снижении способности адаптироваться к изменяющимся условиям среды вследствие многолетней селекции на максимальную яичную продуктивность. В работе этих авторов при использовании в рационах водорастворимого антиоксиданта дигидроэтоксихина снижалось содержание продуктов ПОЛ, а также холестерола во фракциях липопротеинов различной плотности (34).

Неспецифическая резистентность — это способность сохранять в органах, системах или во всем организме режим оптимального функционирования как в стереотипных, так и в изменившихся условиях при всевозможных воздействиях (35). Решающим звеном в цепи среда—реакция организма—продуктивность следует считать генотип (36). При изучении показателей неспецифического иммунитета у петушков мы выявили различия в показателях в зависимости от генотипа птицы (табл. 2).

Устойчивость птицы во многом определяется степенью гуморального иммунитета. Лизоцим, выполняя в организме важные биологические функции (бактерицидные свойства, стимулирующее воздействие на фагоцитоз, нейтрализация некоторых микробных токсинов, противовоспалительный эффект) служит одним из ключевых гуморальных факторов врожденного иммунитета. Ген лизоцима постепенно активируется в зрелых макрофагах (37).

У бройлеров мы выявили наибольшее содержание и самую высокую активность лизоцима в сыворотке крови (0,47 мкг/мл и 3,14 AU/TP, p < 0,001) при снижении процента лизиса (36,1 % против 45,6-48,7 % у остальных петушков, p < 0,05). То есть механизм активации гуморального иммунитета у птицы разных генотипов был неодинаков. По мнению В.Г. Овсянникова с соавт. (38), гуморальные факторы врожденного иммунитета вовлекаются в острый алгогенный процесс, обеспечивая превентивную защиту от внедрения в организм микробного агента. Эта реакция непродолжительна, но следует отметить, что у бройлеров она была сильнее.

Цитокины представляют собой полипептиды или гликопротеины, которые синтезируются и секретируются в основном иммунными клетками. Цитокины участвуют в реакциях неспецифической резистентности, клеточного и гуморального иммунитета (39). Интерлейкины, цитокины, фактор некроза опухоли — основные медиаторы воспаления, секретируемые иммунными клетками для управления воспалительной реакцией. Провоспалительные цитокины (в том числе IL-6, IL-8) усиливают клеточный и ингибируют гуморальный иммунитет (40), при этом играют основную роль в формировании противовирусной защиты.

Как будет показано далее, у бройлеров экспрессия генов провоспалительных цитокинов (в первую очередь IL-8) была в целом ниже, а у петушков русской белой породы и помесей повышалась в тканях слепого отростка кишечника и печени, это могло снижать гуморальный ответ, что проявилось в уменьшении БАСК (см. табл. 2). IL-6 же, подавляя секрецию провоспалительных цитокинов, играет роль противовоспалительного фактора.

В.И. Фисинин с соавт. (41) показали, что титр лизоцима, коррелирующий с количеством цитокинов и глюкокортикоидных гормонов, может служить маркером стресса. Цитокины опосредуют взаимодействие между клетками и выполняют различные биологические функции, в частности регулируют рост, дифференцировку и созревание клеток, иммунный ответ, участвуют в воспалениях и заживлении ран. Снижение количества цитокинов может замедлить дифференцировку стволовых клеток в зрелые иммунные клетки и привести к снижению устойчивости к болезням (42). Санитарно-бактериологические показатели микроклимата на птицефабрике влияют на общее клиническое состояние и сохранность поголовья, поэтому необходимо уделять внимание резистентности птицы с учетом направления ее продуктивности. Чтобы обеспечить оптимальную продуктивность, важно контролировать и при необходимости модулировать иммунный ответ для поддержания гомеостаза.

Адаптация к стрессам происходит на уровне генов, которые получили название витагенов. К ним относятся гены, ответственные за синтез защитных молекул, включая белки теплового шока, иммуноглобулины, антиоксидантные ферменты (43). Изучение экспрессии этих генов представляет собой новый подход к диагностике и профилактике стрессов на молекулярном уровне (44). Наши исследования показали, что транскрипционная активность анализируемых генов зависит не только от генотипа птицы, но и от органа и ткани, в которых эти гены экспрессируются (табл. 3).

Биологическая роль супероксиддисмутазы (СОД) состоит в том, что она катализирует дисмутацию супероксидного радикала в перекись водорода. Глутионпероксидаза катализирует реакцию и восстанавливает перекись водорода до воды, используя восстановленный глутатион в качестве ко-субстрата. На тканеспецифическую экспрессию и активность SOD и GSH-Gpx влияют различные факторы, включая генетические, алиментарные и связанные со стрессом (45). Гемоксигеназа 1 известна как белок теплового шока-32 (HSP32), отвечает за деградацию гема с образованием монооксида углерода, биливердина и свободного железа. Подобно HSP70,HO-1 — это индуцируемая стрессом одна из трех описанных на сегодняшний день изоформ HO, обеспечивающая критический защитный механизм в системах, которые отвечают за адаптацию к окислительному, воспалительному и цитотоксическому стрессу (46).В большинстве тканей HO-1 экспрессируется на относительно низком уровне и может индуцироваться различными повреждениями, связанными с окислительным стрессом (гем, ультрафиолетовое излучение, тяжелые металлы, цитокины, перекись водорода, оксид азота NO, истощение глутатиона) (47).

В слепых отростках кишечника птицы трех генотипов наблюдались различия в экспрессии генов CAT, GSH-Gpx, HO-1, SOD. У CORN × RW по сравнению с русской белой породой относительная экспрессия GSH-Gpx была выше в 2,84 раза (р = 0,006), CAT — в 2,42 раза (р = 0 ,004), HO-1 — в 2,18 раза (р = 0,01), SOD — в 2,0 раза (р = 0,02). У бройлеров отмечали повышение относительной экспрессии CAT и GSH-Gpx в 5 раз по сравнению с группой птицы яичной породы (соответственно р = 0,0007 и р = 0,0008), HO-1 — в 2 раза (р = 0,01), SOD — на 40 %. Полученные данные согласуются с результатами по активности фермента каталазы и восстановленного глутатиона в крови бройлеров.

В печени петушков также выявили различия в экспрессии генов, связанных с антиоксидантной защитой. У CORN × RW экспрессия этих генов в тканях печени была выше, чем у RW: HO-1 — в 119 раз (р = 0,001), SOD — на 33 %, GSH-Gpx — на 57 %, а CAT — на 14 %.  В печени у бройлеров обнаружили снижение относительной экспрессии генов антиоксидантной защиты SOD и GSH-Gpx в 5-6 раз по сравнению с группой RW (р = 0,005). Относительная экспрессия САТ у бройлеров оказалась больше на 27 %, НО-1 — в 42 раза (р = 0,001).

Фактор транскрипции Nrf2 наиболее известен как один из основных участников развития реакции клеток на ксенобиотики и окислительный стресс. В недавних исследованиях идентифицированы новые гены-мишени Nrf2 и выявлено несколько дополнительных функций Nrf2, которые выходят за рамки его окислительно-восстановительных свойств, включая регуляцию воспаления, аутофагии, метаболизма, протеостаза и реакции денатурации белков. Nrf2 стал основным объектом исследований, связанных с воспалением, метаболизмом, профилактикой и лечением рака, поскольку его функции более обширны, чем предполагалось изначально (48).

В слепых отростках кишечника экспрессия транскрипционного фактора Nrf2 у бройлеров была в 1,5 раза выше по сравнению с контролем. В тканях печени у птицы CORN × RW экспрессия Nrf2 оказалась в 2 раза ниже контроля (р = 0,02), у бройлеров — сопоставима с контролем.

К системе неспецифического иммунитета относятся b-дефензины и интерлейкины. IL-6 представляет собой многофункциональный цитокин, который участвует в воспалительных реакциях.IL-8 (член семейства хемокинов CXC) служит хемоаттрактантом для лейкоцитов, активация которого приводит к провоспалительным реакциям, таким как окислительный взрыв и усиление гибели клеток. IL-8 у кур был впервые выделен из фибробластов. Известно, что при стрессе происходит увеличение количества интерлейкинов, которое обусловлено развитием воспалительной реакции. Стресс может вызывать изменения в регуляции иммунной системы посредством увеличения активности интерлейкинов, а именно IL-6 — основного медиатора воспалительных и иммунных реакций (49, 50).

В слепых отростках кишечника петушков CORN × RW экспрессия генов AvBD9 и IL6 была выше по сравнению с птицей яичной породы в 1,8 раза (соответственно р = 0,005 и р = 0,004), IL8 — в 5 раз (р = 0,009). В печени у CORN × RW наблюдалась аналогичная ситуация: относительная экспрессия IL6 была больше, чем у RW, в 3,43 раза (р = 0,006), AvBD9 — в 25,50 раза (р = 0,009), IL8 — в 1,56 раза (р = 0,05).

У бройлеров в слепых отростках относительная экспрессия IL6 оказалась выше, чем у RW, в 1,76 раза (р = 0,03), AvBD9 — в 3,22 раза (р = 0,002). При этом экспрессия IL8, который активируется во время инфекций, у бройлеров была ниже примерно на 30 % по сравнению с птицей яичной породы. В печени бройлеров экспрессия AvBD9 была выше, чем у RW, в 19,15 раза (р = 0,001), но гены IL6 и IL8 экспрессировались в меньшей степени, чему у птицы русской белой породы.

Мы также рассчитали корреляции по Пирсону между относительной экспрессией генов иммунитета и АОЗ в разных тканях (в слепых отростках кишечника и в печени) и в связи с интенсивностью роста птицы всех трех генотипов (табл. 4).

Среднесуточный прирост живой массы у птицы (ССП) в очень высокой степени коррелировал с экспрессией генов CAT (r = 0,998 при р = 0,03) и AvBD-9 (r = 0,999 при р = 0,016) в слепых отростках кишечника. В слепой кишке также отмечали высокие корреляции между экспрессией генов CAT и AvBD-9 (r = 0,999 при р = 0,014), IL6 и HO-1 (r = 0,999 при р = 0,1). Таким образом, гены антиоксидантной защиты и иммунитета тесно связаны между собой, что подтверждает связь между АОЗ организма и здоровьем птицы. В.Г. Нарушин с соавт. (51) определили корреляции между экспрессией некоторых генов иммунитета и биохимическими и иммунологическими показателями крови у кур-несушек. Наиболее информативными биохимическими и иммунологическими показателями крови оказались содержание мочевины, азота мочевины, глюкозы и активность иммуноглобулина IgG2.

В нашей работе не было установлено достоверных корреляций между ССП и экспрессией генов, связанных с АОЗ и иммунитетом, в печени птицы (см. табл. 4). Там же мы не обнаружили статистически значимых корреляций между экспрессией указанных генов. Это требует проведения исследований, которые мы предполагаем провести использованием дополнительных компонентов рациона для повышения антиоксидантного и иммунного статуса птицы и улучшения качества продукции.

Итак, на примере петушков кросса Ross 308, русской белой породы и помесей пород русская белая и корниш показано, что генотип птицы определяет состояние антиоксидантной системы организма, которое отражается на накоплении продуктов перекисного окисления липидов (ПОЛ), функции ферментативного звена антиоксидантной защиты (АОЗ), общем антиоксидантном статусе и иммунном ответе. У бройлеров кросса Ross 308 отмечалось более высокое накопление продуктов ПОЛ, что требует особого напряжения в антиоксидантной системе и может компенсироваться высоким суммарным содержанием водорастворимых антиоксидантов и активностью каталазы. Данные по экспрессии генов антиоксидантных ферментов и иммунитета в слепых отростках кишечника и в печени птицы подтверждают результаты биохимических исследований крови. Нами впервые установлены корреляции между экспрессией некоторых генов ферментов АОЗ и иммунитета в слепых отростках кишечника, тканях печени и среднесуточным приростом живой массы петушков, а также между относительной экспрессией генов, что подтверждает связь между АОЗ и здоровьем птицы. Полученные данные подтверждают актуальность изучения и применения в бройлерном производстве способов снижения окислительного стресса и создания дополнительной защиты для антиоксидантной системы у интенсивно растущей птицы. В дальнейшем мы планируем изучить возможность снизить воздействие стрессов (в том числе окислительного стресса) на здоровье птицы и качество получаемой от нее мясной продукции, используя алиментарные факторы.

 

1. Показатели антиоксидантной защиты и перекисного окисления липидов у петушков (Gallus gallus domesticus) разных генотипов (физиологический двор ФГБНУ ФИЦ животноводства — ВИЖ им. Л.К. Эрнста, 2022 год)

Показатель

M

min

max

±SEM

±SD

Cv, %

Русская белая порода (n = 28)

ТБК-АП, мкмоль/л

3,04*

2,26

4,10

0,08

0,43

14,22

ЦП, мг/л

62,53

38,00

117,00

3,43

18,14

29,00

СКВА, мг/л

45,20

29,43

75,54

2,02

10,67

12,61

Глутатион восстановленный, мкмоль/л

23,84***

11,47

37,74

2,04

7,62

31,96

СОД, Ед/мл

19,45***

17,58

20,19

0,22

0,83

4,25

Каталаза, Ед/л

52,25*

6,67

196,06

14,16

52,97

101,37

ОАС, ммоль/л

0,69

0,28

0,95

0,04

0,15

22,09

ТБК-АП/ЦП

0,05

 

 

 

 

 

Бройлеры кросса Ross 308 (n = 9)

ТБК-АП, мкмоль/л

4,27

1,95

6,87

0,57

1,70

39,78

ЦП, мг/л

37,78†††

25,00

66,00

3,95

11,84

31,34

СКВА, мг/л

49,78

42,28

59,46

1,61

4,82

9,69

Глутатион восстановленный, мкмоль/л

38,26

29,83

48,84

2,23

6,69

17,48

СОД, Ед/мл

15,22

10,89

18,03

0,76

2,27

14,90

Каталаза, Ед/л

100,50

46,06

217,27

17,69

53,07

52,80

ОАС, ммоль/л

0,64

0,36

0,99

0,07

0,21

33,15

ТБК-АП/ЦП

0,11

 

 

 

 

 

Помеси пород русская белая и корниш

ТБК-АП, мкмоль/л (n = 128)

2,79**

1,33

5,23

0,06

0,72

25,72

ЦП, мг/л (n = 128)

41,94††

23,00

78,00

0,99

11,16

26,62

СКВА, мг/л (n = 128)

41,03***

22,80

73,55

0,97

11,00

26,81

Глутатион восстановленный, мкмоль/л (n = 26)

22,02***

7,86

44,91

2,01

10,26

46,59

СОД, Ед/мл (n = 27)

19,30***

16,57

21,21

0,20

1,04

5,41

Каталаза, Ед/л (n = 7)

32,94**

11,81

61,81

6,68

17,69

53,72

ОАС, мМ/л (n = 27)

0,78†

0,59

1,37

0,03

0,16

20,27

ТБК-АП/ЦП

0,07

 

 

 

 

 

Примечание. ТБК-АП — продукты, реагирующие с тиобарбитуровой кислотой, СКВА — суммарное количество водорастворимых антиоксидантов, ЦП — церулоплазмин, СОД — супероксидисмутаза, ОАС — общий антиоксидантный статус.
*, **, *** Различия по сравнению с бройлерами статистически значимы соответственно при p < 0,05, p < 0,01, p < 0,001; †, ††, ††† — по сравнению с русской белой породой соответственно при p < 0,05, p < 0,01, p < 0,001.

 

2. Показатели неспецифического иммунитета у петушков (Gallus gallus domesticus) разных генотипов (физиологический двор ФГБНУ ФИЦ животноводства — ВИЖ им. Л.К. Эрнста, 2022 год)

Показатель

M

min

max

±SEM

±SD

Cv, %

Русская белая порода (n = 12)

Лизис, %

48,70*

32,87

64,59

2,56

8,85

18,17

Лизоцим, мкг/мл сыворотки

0,36*

0,22

0,45

0,02

0,06

16,53

Активность лизоцима, AU/TP

2,42†

1,27

3,32

0,16

0,56

23,09

БАСК, %

55,32*†

37,10

66,00

2,44

8,47

15,31

Бройлеры кросса Ross-308 (n = 9)

Лизис, %

36,10

16,07

56,92

4,94

14,82

41,05

Лизоцим, мкг/мл сыворотки

0,47

0,34

0,80

0,05

0,15

31,71

Активность лизоцима, AU/TP

3,14

2,02

6,17

0,43

1,28

40,92

БАСК, %

35,14

5,20

54,00

7,09

21,27

60,51

Помеси пород русская белая и корниш (n = 68)

Лизис, %

45,60*

9,38

91,50

2,29

18,87

41,38

Лизоцим, мкг/мл сыворотки

0,25***

0,05

0,50

0,01

0,10

41,94

Активность лизоцима, AU/TP

1,34***

0,07

3,16

0,11

0,89

66,14

БАСК, %

37,99

16,40

69,90

1,44

11,90

31,33

Примечание. БАСК — бактерицидная активность сыворотки крови.
*, ** Различия статистически значимы по сравнению с бройлерами соответственно при p < 0,05, p < 0,001; † — по сравнению с помесной птицей при p < 0,001.

 

3. Относительная экспрессия (ед.) генов в слепых отростках кишечника и в печени у петушков (Gallus gallus domesticus)
разных генотипов
(M±SEM, физиологический двор ФГБНУ ФИЦ животноводства — ВИЖ им. Л.К. Эрнста, 2022 год)

Генотип

Ген

CAT

GSH-Gpx

HO-1

SOD

AvBD9

IL6

IL8

NrF2

Слепые отростки кишечника

RW (К) (n = 10)

1

1

1

1

1

1

1

1

CORN × RW (n = 11)

2,42±0,169

2,84±0,257

2,18±0,163

2,04±0,219

1,82±0,095

1,87±0,093

5,18±0,692

1,16±0,157

Ross 308 (n = 9)

5,06±0,274

4,73±0,270

2,05±0,216

1,41±0,155

3,22±0,189

1,76±0,215

0,67±0,052

1,58±0,210

Печень

RW (К) (n = 10)

1

1

1

1

1

1

1

1

CORN × RW (n = 11)

1,14±0,110

1,57±0,155

119,63±9,005

1,33±0,132

25,52±4,294

3,43±0,371

1,58±0,178

0,52±0,100

Ross-308 (n = 9)

1,27±0,099

0,15±0,066

42,19±3,486

0,18±0,012

19,15±1,391

0,98±0,100

0,46±0,090

0,96±0,129

Примечание. RW — русская белая порода (контроль — К), Ross 308 — бройлеры кросса Ross 308,
CORN × RW — помесь пород русская белая и корниш, 2; CAT — каталаза, GSH-Gpx — глутатионпероксидаза, HO-1 — гемоксигеназа 1,
SOD — суперок-сиддисмутаза, NrF2 — родственный фактор транскрипции 2, AvBD9 — птичий бета дефензин 9, IL6 — интерлейкин 6,
IL8 —интерлейкин 8. В графической форме результаты представлены на http://www.agrobiology.ru.

 

4. Корреляционные связи (r) между относительной экспрессии генов антиоксидантной защиты и иммунитета в зависимости от их локализации и в связи с интенсивностью роста у петушков (Gallus gallus domesticus) разных генотипов (n = 30, физиологический двор ФГБНУ ФИЦ животноводства — ВИЖ им. Л.К. Эрнста, 2022 год)

Показатель

Ген

CAT

GSH-Px

HO-1

SOD

AvBD-9

IL6

IL8

Nrf2

Слепые отростки кишечника

ССП

0,998
(р = 0,03)

0,993

0,733

0,275

0,999
(р = 0,016)

0,722

-0,189

0,992

CAT

 

0,987

0,700

0,228

0,999
(р = 0,014)

0,688

-0,235

0,997

GSH-Px

0,987

 

0,807

0,384

0,990

0,798

-0,073

0,970

HO-1

0,700

0,807

 

0,855

0,715

0,999
(р = 0,10)

0,530

0,639

SOD

0,226

0,384

0,855

 

0,250

0,863

0,893

0,148

AvBD-9

0,999
(р = 0,014)

0,990

0,715

0,250

 

0,704

-0,214

0,995

IL6

0,688

0,798

0,999
(р = 0,1)

0,863

0,704

 

0,543

0,927

IL8

-0,235

-0,073

0,530

0,893

-0,214

0,543

 

-0,314

Nrf2

0,997

0,970

0,639

0,148

0,995

0,630

-0,314

 

Печень

ССП

0,989

-0,690

0,223

-0,776

0,622

-0,131

-0,587

0,049

CAT

 

-0,577

0,362

-0,677

0,728

0,014

-0,463

-0,096

GSH-Px

-0,577

 

0,552

0,992

0,139

0,808

0,991

-0,757

HO-1

0,362

0,552

 

0,441

0,903

0,937

0,658

-0,963

SOD

-0,677

0,991

0,441

 

0,012

0,726

0,966

-0,667

AvBD-9

0,728

0,139

0,903

0,012

 

0,696

0,270

-0,752

IL6

0,014

0,808

0,937

0,726

0,696

 

0,880

-0,997

IL8

-0,463

0,991

0,658

0,966

0,270

0,880

 

-0,837

Nrf2

-0,096

-0,757

-0,963

-0,667

-0,752

-0,997

-0,837

 

Примечание. ССП — среднесуточный прирост живой массы, CAT — каталаза, GSH-Gpx — глутатионпероксидаза, HO-1 — гемоксигеназа 1, SOD — супероксиддисмутаза, Nrf2 — родственный фактор транскрипции 2, AvBD9 — птичий b-дефензин 9, IL6 — интерлейкин 6, IL8 — интерлейкин 8.

 

ЛИТЕРАТУРА

  1. Боголюбова Н.В., Некрасов Р.В., Зеленченкова А.А. Антиоксидантный статус и качество мяса у сельскохозяйственной птицы и животных при стрессе и его коррекция с помощью адаптогенов различной природы (обзор). Сельскохозяйственная биология, 2022, 57(4): 628-663 (doi: 10.15389/agrobiology.2022.4.628rus).
  2. Xing T., Gao F., Tume R.K., Zhou G., Xu X. Stress effects on meat quality: a mechanistic perspective. Comprehensive Reviews in Food Science and Food Safety, 2019, 18(2): 380-401 (doi: 10.1111/1541-4337.12417).
  3. Zhang W., Xiao S., Lee E.J., Ahn D.U. Consumption of oxidized oil increases oxidative stress in broilers and affects the quality of breast meat. J. Agric. Food Chem., 2011, 59(3): 969-974 (doi: 10.1021/jf102918z).
  4. Sihvo H.K., Immonen K., Puolanne E. Myodegeneration with fibrosis and regeneration in the pectoralis major muscle of broilers. Veterinary Pathology, 2014, 51(3): 619-623 (doi: 10.1177/0300985813497488).
  5. Surai P.F., Kochish I.I., Fisinin V.I., Kidd M.T. Antioxidant defence systems and oxidative stress in poultry biology: an update. Antioxidants, 2019, 8(7): 235 (doi: 10.3390/antiox8070235).
  6. Estévez M. Oxidative damage to poultry: from farm to fork. Poultry Science, 2015, 94(6): 1368-1378 (doi: 10.3382/ps/pev094).
  7. Belhadj Slimen I., Najar T., Ghram A., Abdrrabba M.J.O.A.P. Heat stress effects on livestock: molecular, cellular and metabolic aspects, a review. Journal of Animal Physiology and Animal Nutrition, 2016, 100(3): 401-412 (doi: 10.1111/jpn.12379).
  8. Wen C., Chen Y., Leng Z., Ding L., Wang T., Zhou Y. Dietary betaine improves meat quality and oxidative status of broilers under heat stress. Journal of the Science of Food and Agriculture, 2019, 99(2): 620-623 (doi: 10.1002/jsfa.9223).
  9. Wein Y., Bar Shira E., Friedman A. Avoiding handling-induced stress in poultry: use of uniform parameters to accurately determine physiological stress. Poultry Science, 2017, 96(1): 65-73 (doi: 10.3382/ps/pew245).
  10. Radi R. Oxygen radicals, nitric oxide, and peroxynitrite: redox pathways in molecular medicine. Proceedings of the National Academy of Sciences, 2018, 115(23): 5839-5848 (doi: 10.1073/pnas.1804932115).
  11. Ludin A., Gur-Cohen S., Golan K., Kaufmann K.B., Itkin T., Medaglia C., Lu X.J., Ledergor G., Kollet O., Lapidot T. Reactive oxygen species regulate hematopoietic stem cell self-renewal, migration and development, as well as their bone marrow microenvironment. Antioxidants & Redox Signaling, 2014, 21(11): 1605-1619 (doi: 10.1089/ars.2014.5941).
  12. Mavangira V., Sordillo L.M. Role of lipid mediators in the regulation of oxidative stress and inflammatory responses in dairy cattle. Research in Veterinary Science, 2018, 116: 4-14 (doi: 10.1016/j.rvsc.2017.08.002).
  13. Mesa-Garcia M.D., Plaza-Diaz J., Gomez-Llorente C. Molecular basis of oxidative stress and inflammation. In: Obesity /A.M. del Moral, C.M.A. García (eds.). Academic Press, Sandiego, 2018: 41-62.
  14. McCarthy C.G., Saha P., Golonka R.M., Wenceslau C.F., Joe B., Vijay‐Kumar M. Innate immune cells and hypertension: neutrophils and neutrophil extracellular traps (NETs). Comprehensive Physiology, 2021, 11(2): 1575-1589 (doi: 10.1002/cphy.c200020).
  15. Ratnam D.V., Ankola D.D., Bhardwaj V., Sahana D.K., Kumar M.N. Role of antioxidants in prophylaxis and therapy: a pharmaceutical perspective. Journal of Controlled Release, 2006, 113(3): 189-207 (doi: 10.1016/j.jconrel.2006.04.015).
  16. Котарев В.И., Алехин Ю.Н., Долгополов В.Н. Влияние возрастных изменений в организме кур родительского стада на метаболический статус потомства. Ветеринарный фармакологический вестник, 2017, 1(1): 73-79.
  17. Mattioli S., Cartoni Mancinelli A., Menchetti L., Dal Bosco A., Madeo L., Guarino Amato M., Moscati L., Cotozzolo E., Ciarelli C., Angelucci E., Castellini C. How the kinetic behavior of organic chickens affects productive performance and blood and meat oxidative status: a study of six poultry genotypes. Poultry Science, 2021, 100(9): 101297 (doi: 10.1016/j.psj.2021.101297).
  18. Lengkidworraphiphat P., Wongpoomchai R., Taya S., Jaturasitha S. Effect of genotypes on macronutrients and antioxidant capacity of chicken breast meat. Asian-Australasian Journal of Animal Sciences, 2020, 33(11): 1817-1823 (doi: 10.5713/ajas.19.0736).
  19. Кондрахин И.П., Архипов А.В., Левченко В.И., Таланов Г.А., Фролова Л.А., Новиков В.Э. Методы ветеринарной клинической лабораторной диагностики. М., 2004.
  20. Воронин Е.С., Петров А.М., Серых М.М., Девришов Д.А. Иммунология /Под ред. Е.С. Воронина. М., 2002.
  21. Соловых Г.Н., Минакова В.В., Коробов В.П., Лемкина Л.М., Карнаухова И.В., Рябцева Е.А., Кануникова Е.А. Способ определения лизоцимной активности биологических объектов. Патент RU 2294373C2. 2294373C2 (РФ) ГОУ ВО «Оренбургская государственная медицинская академия» (РФ). № 2005103265/13A. Заявл.08.02.2005. Опубл.27.02.2007.
  22. Meza Cerda M.-I., Gray R., Higgins D.P. Cytokine RT-qPCR and ddPCR for immunological investigations of the endangered Australian sea lion (Neophoca cinerea) and other mammals. PeerJ, 2020, 8: e10306 (doi: 10.7717/peerj.10306).
  23. Laptev G.Y., Filippova V.A., Kochish I.I., Yildirim E.A., Ilina L.A., Dubrovin A. V, Brazhnik E.A., Novikova N.I., Novikova O.B., Dmitrieva M.E., Smolensky V.I., Surai P.F., Griffin D.K., Romanov M.N. Examination of the expression of immunity genes and bacterial profiles in the caecum of growing chickens infected with Salmonella enteritidis and fed a phytobiotic. Animals, 2019, 9(9): 615 (doi: 10.3390/ani9090615).
  24. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods, 2001, 25(4): 402-408 (doi: 10.1006/meth.2001.1262).
  25. Владимиров Ю.А., Арчаков А.И. Перекисное окисление липидов в биологических мембранах. М., 1972.
  26. Kapuy O., Papp D., Vellai T., Banhegyi G., Korcsmaros T. Systems-level feedbacks of NRF2 controlling autophagy upon oxidative stress response. Antioxidants, 2018, 7(3): 39 (doi: 10.3390/antiox7030039).
  27. Маханова Р.С. К вопросу изучения перекисного окисления липидов. Известия Оренбургского государственного аграрного университета, 2011, 1(29-1): 231-234.
  28. Całyniuk B., Grochowska-Niedworok E., Walkiewicz K.W., Kawecka S., Popiołek E., Fatyga E. Malondialdehyde (MDA)—product of lipid peroxidation as marker of homeostasis disorders and aging. Annales Academiae Medicae Silesiensis — Śląski Uniwersytet Medyczny w Katowicach, 2016, 70: 224-228 (doi: 10.18794/aams/65697).
  29. Linder M.C. Ceruloplasmin and other copper binding components of blood plasma and their functions: an update. Metallomics, 2016, 8(9): 887-905 (doi: 10.1039/c6mt00103c).
  30. Wu R., Feng J., Yang Y., Dai C., Lu A., Li J., Liao Y., Xiang M., Huang Q., Wang D., Du X. Significance of serum total oxidant/antioxidant status in patients with colorectal cancer. PLoS ONE, 2017, 12(1): e0170003 (doi: 10.1371/journal.pone.0170003).
  31. Горлов И.Ф., Тихонов С.Л., Тихонова Н.В. Стрессоустойчивость как фактор формирования качества мяса с нехарактерным ходом автолиза. Индустрия питания, 2016, 1: 44-53.
  32. Pigeolet E., Corbisier P., Houbion A., Lambert D., Michiels C., Raes M., Zachary M.D., Remacle J. Glutathione peroxidase, superoxide dismutase, and catalase inactivation by peroxides and oxygen derived free radicals. Mechanisms of Ageing and Development, 1990, 51(3): 283-297 (doi: 10.1016/0047-6374(90)90078-T).
  33. Madkour M., Aboelazab O., Abd El-Azeem N., Younis E., Shourrap M. Growth performance and hepatic antioxidants responses to early thermal conditioning in broiler chickens. Journal of Animal Physiology and Animal Nutrition, 2023, 107(1): 182-191 (doi: 10.1111/jpn.13679).
  34. Остренко К.С., Галочкина В.П. Влияние водорастворимого антиоксиданта дигидроэтоксихина на продуктивность кур и инкубационные качества яиц. Ветеринария, 2020, 11: 53-58.
  35. Stoyanovskyy V.G., Krogh A.O., Kolomiіets I.A. Adaptation of the status of non-specific resistance of the ducks organism in stress conditions inclusion in the ration of probiotical additives. Scientific Messenger of LNU of Veterinary Medicine and Biotechnologies, 2018, 20(87): 32-37 (doi: 10.15421/nvlvet8706).
  36. Madej J.P., Skonieczna J., Siwek M., Kowalczykc A., Łukaszewicz E., Slawinska A. Genotype-dependent development of cellular and humoral immunity in the spleen and cecal tonsils of chickens stimulated in ovo with bioactive compounds. Poultry Science, 2020, 99(9): 4343-4350 (doi: 10.1016/j.psj.2020.05.048).
  37. Van Phi L. Transcriptional activation of the chicken lysozyme gene by NF-kappa Bp65 (RelA) and c-Rel, but not by NF-kappa Bp50. Biochem. J., 1996, 313(1): 39-44 (doi: 10.1042/bj3130039).
  38. Овсянников В.Г., Алексеев В.В., Бойченко А.Е., Лабушкина А.В., Алексеева Н.С., Абрамова М.В., Алексеева Н.А. Гуморальные и клеточные факторы врожденного иммунитета при раздражениях неантигенной природы. Сообщение II. Журнал фундаментальной медицины и биологии, 2015, 4: 4-13.
  39. Gulati K., Guhathakurta S., Joshi J., Rai N., Ray A. Cytokines and their role in health and disease: a brief overview. MOJImmunol., 2016, 4(2): 00121 (doi: 10.15406/moji.2016.04.00121).
  40. Ершов Ф.И. Цитокины — новое поколение биотерапевтических препаратов. Вестник РАМН, 2006, 9-10: 45-50.
  41. Фисинин В.И., Митюшников В., Кравченко Н. Оптимальные сроки перемещения молодняка и профилактика стресса пересадки. Птицеводство, 1977, 7: 28-30.
  42. Song B., Tang D., Yan S., Fan H., Li G., Shahid M.S., Mahmood T., Guo Y. Effects of age on immune function in broiler chickens. J. Animal Sci. Biotechnol., 2021, 12: 1-12 (doi: 10.1186/s40104-021-00559-1).
  43. Surai P.F., Fisinin V.I. Vitagenes in poultry production: Part 1. Technological and environmental stresses. World's Poultry Science Journal, 2016, 72(4): 721-733 (doi: 10.1017/S0043933916000714).
  44. Мифтахутдинов А.В. Экспериментальные подходы к диагностике стрессов в птицеводстве (обзор). Сельскохозяйственная биология, 2014, 2: 20-30 (doi: 10.15389/agrobiology.2014.2.20rus).
  45. Surai P.F. Antioxidant systems in poultry biology: superoxide dismutase. Journal of Animal Research and Nutrition, 2016, 1(1): 8 (doi: 10.21767/2572-5459.100008).
  46. Maamoun H., Benameur T., Pintus G., Munusamy S., Agouni A. Crosstalk between oxidative stress and endoplasmic reticulum (ER) stress in endothelial dysfunction and aberrant angiogenesis associated with diabetes: a focus on the protective roles of heme oxygenase (HO)-1. Front. Physiol., 2019, 10: 70 (doi: 10.3389/fphys.2019.00070).
  47. Waza A.A., Hamid Z., Ali S., Bhat S.A., Bhat M.A. A review on heme oxygenase-1 induction: Is it a necessary evil. Inflamm. Res., 2018, 67: 579-588 (doi: 10.1007/s00011-018-1151-x).
  48. He F., Ru X., Wen T. NRF2, a transcription factor for stress response and beyond. International Journal of Molecular Sciences, 2020, 21(13): 4777 (doi: 10.3390/ijms21134777).
  49. Сарапульцев П.А., Сарапульцев А.П. Стресс и иммунная система. Цитокины и воспаление, 2014, 3(4): 5-10.
  50. Li Y., Ma Q.-G., Zhao L.-H., Wei H., Duan G.-X., Zhang J.-Y., Ji C. Effects of lipoic acid on immune function, the antioxidant defense system, and inflammation-related genes expression of broiler chickens fed aflatoxin contaminated diets. InternationalJournalofMolecularSciences, 2014, 15(4): 5649-5662 (doi: 10.3390/ijms15045649).
  51. Нарушин В.Г., Селина М.В., Романов М.Н. Анализ сопряженных изменений экспрессии генов и биохимических показателей крови в эксперименте на курах-несушках. Мат. Межд. науч.-практ. конф. «Молекулярно-генетические технологии для анализа экспрессии генов продуктивности и устойчивости к заболеваниям животных». М., 2019: 67-82.

 

 

BIOCHEMICAL AND MOLECULAR GENETIC INDICATORS OF ANTIOXIDANT PROTECTION AND IMMUNITY IN MALE CHICKS (Gallus gallus domesticus) OF DIFFERENT GENOTYPES

N.V. Bogolyubova ✉, R.V. Nekrasov, D.A. Nikanova, A.A. Zelenchenkova, N.S. Kolesnik, R.A. Rykov, N.A. Volkova,
A.N. Vetokh, L.A. Ilina

ORCID:
Bogolyubova N.V. orcid.org/0000-0002-0520-7022
Rykov R.A. orcid.org/0000-0003-0228-8901
Nekrasov R.V. orcid.org/0000-0003-4242-2239
Volkova N.A. orcid.org/0000-0001-7191-3550
Nikanova D.A. orcid.org/0000-0001-5164-244X
Vetokh A.N. orcid.org/0000-0002-2865-5960
Zelenchenkova A.A. orcid.org/0000-0001-8862-3648
Ilina L.A. orcid.org/0000-0003-2789-4844
Kolesnik N.S. orcid.org/0000-0002-4267-5300

A comparative study of the relationship between the antioxidant protection (AOP) and immunity in poultry of various genotypes is relevant for clinical and physiological assessment of health status and the search for combinations of genotypes to obtain new crosses. In this work, for the first time, differences in biochemical and molecular genetic indicators of antioxidant protection and immunity were established for the Russian White, Ross 308 cross, and Russian White × Cornish cockerels. Correlations were revealed between the expression of some genes for AOP and immunity enzymes in caecum and liver tissues, and the average daily weight gain. The aim of the work was to assess the factors of immunity and antioxidant status, nonspecific immunity indicators, and gene expression levels for enzymes involved in antioxidant protection and immune response in male chickens (Gallus gallus domesticus) of different genotypes. The studies were carried out in 2022 at physiological yard of the Ernst Federal Research Center for Animal Husbandry. Blood samples were taken from Russian White cockerels (RW, n = 28), Ross 308 cross broilers (n = 9) and Russian White × Cornish cockerels (CORN × RW, n = 128) at slaughter at the age of 9 weeks. The TBA test with thiobarbituric acid to measure the TBA-active products (TBA-AP) was performed with Agat-Med kits (Russia). The activity of ceruloplasmin (CP) was determined by the Revin method, the amount of total water-soluble antioxidants (TAWSA) amperometrially (a TsvetYauza-01-AA with an amperometric detector, Khimavtomatika, Russia), the ratio of TBA-AP to the CP was calculated. TAWSA was evaluated as equivalents to gallic acid using calibration solutions with a mass concentration of 0.2, 0.5, 1.0 and 4.0 mg/dm3 prepared from 100 mg/dm3 gallic acid. A solution of orthophosphoric acid (0.0022 mol/dm3)was used as an eluent. Other indicators of antioxidant status were determined with commercial kits (Elabscience Elabscience Biotechnology, Inc., China). Reduced glutathione (E-BC-K096-M), superoxide dismutase (SOD) (E-BC-K020-M), catalase (E-BC-K031-M) and total antioxidant status (TAS) (E-BC-K219-M) were measured by ELISA test (an Immunochem-2100 microplate photometer, High Technology Inc., USA). Nonspecific immunity (i.e., bactericidal activity BA and lysozyme activity LA) of RW (n = 12), CORN × RW (n = 68) and Ross 308 (n = 9) male chicks were determined (a microbiological analyzer Multiskan FC, ThermoFisher Scientific Inc., Finland). Analysis of relative gene expression was performed using real-time PCR. Tissue samples of the caecum and liver were taken from RW (n = 10), Ross 308 (n = 9), and CORN × RW (n = 11) cockerels, 30 samples of each tissue. The relative expression of the genes responsible for antioxidant protection (catalase CAT, glutathione peroxidase GSH-Gpx, heme oxygenase 1 HO-1, superoxide dismutase SOD, related transcription factor 2, NF-E2 Nrf2) and involved in the immune response (avian beta defensin 9 AvBD9, interleukin 6 IL6, interleukin 8 IL8) was assessed. Total antioxidant status (TAS) of broilers was lower than that of analogues, which was confirmed by the maximum content of TBA-AP, 4.27 vs. 3.04 µmol/l for RW (p < 0.05) and 2.79 µmol/l (p < 0.01) for CORN × RW, with a minimum content of ceruloplasmin (37.78 mg/l), and, accordingly, a higher TBA-AP/CP ratio. In the blood of Ross 308 cross males, the maximum TAWSA was detected (49.78 mg/l at p < 0.001 compared to RW), which was due to the maximum amount of reduced glutathione among analogues (38.26 μmol/l at p < 0.001 compared to RW and p < 0.001 compared to CORN × RW). The blood activity of catalase in broilers was also high (100.50 U/l at p < 0.05 compared to RW and p < 0.01 compared to CORN × RW). However, their antioxidant system must work at the maximum to neutralization of reactive oxygen species (ROS). Our data on the expression of AOP and immunity genes confirmed these conclusions. In the caeca of broilers, the genes CAT and GSH-Gpx expression was 5 times higher compared to egg breed cockerels (p = 0.0007 and p = 0.0008, respectively), HO-1 2 times higher ( p = 0.01), SOD higher by 40 %. In the liver of broilers, there was a decrease in the genes SOD and GSH-Gpx expression by 5-6 times compared to RW (p = 0.005 for both genes), CAT expression increased by 27 %, and HO-1 by 42 times (p = 0.001). In broilers, the blood lysozyme concertation and activity were the highest (0.47 μg/ml and 3.14 AU/TP, p < 0.001) with a decrease in the percentage of lysis (36.1 vs. 45.6-48.7 % in other cockerels, p < 0.05) with the minimum BA among analogues. This is confirmed by the fact that the expression of pro-inflammatory cytokines (primarily IL-8) which inhibit humoral immunity was generally lower in the studied broiler tissues while it increased in males of other genotypes. This could lead to a decrease in the humoral response. The average daily weigh gain of poultry highly correlated with the CAT (r = 0.998 at p = 0.03) and AvBD-9 (r = 0.999 at p = 0.016) expression in the caecum. In the caecum, high correlations were found between the expression of CAT and AvBD-9 (r = 0.999 at p = 0.014), IL6 and HO-1 (r = 0.999 at p = 0.1), which confirms the relationship between AOP and bird health. Ross 308 cross broilers showed a higher accumulation of lipid peroxidation products. This highlights the feasibility of using nutritional factors to reduce oxidative stress and increase the antioxidant potential of the body to improve the quality of poultry products.

Keywords: antioxidant status, immunity, chickens, broilers, genotypes, gene expression, CAT, GSH-Gpx, HO-1, SOD, Nrf2, AvBD9, IL6, IL8.