ЂЂЂ 2 3 й после «рыбьего» на побеге текущего года.
То есть в субтропической зоне России почти ежегодно в июнеЂЂЂавгусте запасы влаги в почве резко сокращаются до критического состояния. Чайное растение предъявляет значительные требования к условиям выращивания сумма активных температур ЂЂЂ не ниже 3000 3500 С количество осадков ЂЂЂ 1300 2000 мм в год при высокой чувствительности к неблагоприятным факторам.

Наиболее быстро и достаточно точно питательность рациона можно определить по обменной энергии животного.
ОЭ в объемистых кормах жвачных животных имеют следующий вид: ОЭ = 10,6 – 0,072 х СК сено, сенаж ОЭ = 7,97 – 0,0373 х СК солома ОЭ = 9,61 – 0,0236 х СК силос ОЭ = 13,78 – 0,154 х СК корнеклубнеплоды ОЭ = 10,8 – 0,024 х СК зеленые корма , где ОЭ — обменная энергия, МДж в 1 кг СВ СК — содержание сырой клетчатки в

Дальнейшее изучение водного дефицита в динамике показало,
Ser . в засушливый период б по сравнению с исходным значением а г. Сочи, 2007 год . В осенний период содержание общей воды в листьях у сравниваемых сортов несколько повышалось, что связано с ослаблением влияния факторов внешней среды, спадом интенсивности транспирации и гидролизом пластических веществ,

The highest average content of lutein was found in fresh flowers of the variety
Orange was also grown on the 1 ha field of All Russia Research and Development Institute of Medicinal and Aromatic Plants Moscow the sowing date April, 24, collecting inflorescences late July. The content of xanthophylls calculated into lutein equivalents was determined by spectrophotometry 9 . To assess the influence of growth conditions on growth and development of the genus

Сбор клейковины зерна с 1 га посева у сортов и линий яровой мягкой пшеницы при разных сроках посева учебно опытное хозяйство «Миловское»,
Среднее: общее 18,2 25,1 13,5 26 27,4 8,8 51 25,8 по линиям 18,2 25,2 13,6 25 27,4 8,9 51 25,7 П р и м е ч а н и е. НСР 05 для сравнения средних значений урожайности у сортов и линий в пределах одного срока посева — 0,8 ц га, разных сроков — 1,4 ц га. Линии, достоверно отличающиеся по урожайности от сорта

При увеличении продолжительности воздействия дифференцированными сигналами до 3 мин доминирующим животным потребовалось меньшее число применений и больше подходов к кормушке,
Достоверность различий между групповыми средними оценивали, используя t критерий Стьюдента. Результаты. Вследствие интрасексуального полового отбора поведение бычков в период формирования иерархии в стаде характеризовалось половым возбуждением, многочисленными вспрыгиваниями животных друг на друга,

Отношение соответственно числа полученных трансгенных цыплят и эмбрионов к числу развившихся эмбрионов,
Препараты просматривали под микроскопом «Opton», Германия и документировали с использованием компьютерной программы Image Scope ООО «Системы для микроскопии и анализа», Россия . Результаты. При оценке тропности ретровирусных генных конструкций в экспериментах с клеточной культурой in vitro и одним из используемых в работе векторов — pLN

Одновременно наблюдалось снижение скорости темнового дыхания на свету.
Образцы освещали лампой накаливания с зеркальным отражателем ЗН 7, Россия , используя водяной фильтр. Измерение световой зависимости СО2 газообмена листьев выполняли при последовательном повышении интенсивности света от 0 до 50 клк. Температура воздуха при культивировании ЂЂЂ 25 С. Световую кривую аппроксимировали моделью

Легко и среднесуглинистые 0,200 0,178 0,96 0,100 0,037 0,87 0,080 0,024 0,64
Cs хорошо описывается совокупностью экспонент, каждая из которых аппроксимирует изменение этого показателя в определенный период времени 3 . Анализ данных, характеризующих изменение КП, показывает, что для разработки регрессионных моделей целесообразно выделить три временных периода. В течение 1 го 1987 1991 годы протекали интенсивные процессы перераспределения и фиксации 137

тренинг на сплочение команды
А 540 при концентрации алюминия 15 мг л М 1 — конечная биомасса С 0 Al — концентрация алюминия, при которой масса микроорганизмов равна полусумме М 0 М 1 2 и соответствует точке перегиба кривых &delta С Al — постоянная величина, характеризующая угол наклона кривой изменения массы микроорганизмов. 2.

Так, содержание витамина С аскорбиновой кислоты в опыте увеличилось соответственно на 38,8 и 25,3 по сравнению с контролем,
Наиболее быстрое формирование ярусов наблюдали у растений гибридов Виллина и Валентина, что сопровождалось ингибированием роста листовых пластинок предыдущих ярусов у гибридов Миракл и Татьяна развитие листовых пластинок предыдущих ярусов продолжалось см. рис. . На поздних стадиях онтогенеза морфометрические показатели растений в опыте и контроле различались меньше,

Интенсивность реализации рефлекса молокоотдачи во многом определяется индивидуальными особенностями коров,
Общая продолжительность доения составила в среднем 276,4 с. Резкое повышение ОСК см. рис. 1, точка D наблюдали через 68,5 с от начала доения. ОСК достигала наибольших значений через 157 с от начала доения или через 88,5 с от начала резкого подъема ОСК . Продолжительность периода повышенных значений

В первом варианте оно имело вид либо 1:1, либо 1:2,
При анализе гибридов учитывали число растений с разным типом метелки, число голых и пленчатых зерен в метелках промежуточного типа без учета зерна промежуточного типа , массу голого и пленчатого зерна с растения. Уборку растений F 2 и F 3 осуществляли комбайнами Hege 125 Австрия . Благоприятные климатические условия для развития растений овса сложились в 2003 году.

ЂЂЂ побеги соответственно 1 го, 2 го и 3 го порядка.
Краевые 9,1 9,3 11,7 14,3 Средние 8,0 6,7 9,7 11,7 Внутренние 5,0 5,0 8,3 10,0 В среднем по группе 8,1 7,0 9,9 12,0 В среднем для побегов порядка 9,3 8,6 10,8 13,9 Средние Краевые 11,5 10,8 13,2 16,3 Средние Средние 9,3 8,3 11,2 12,9 Средние Внутренние 6,9 6,7 9,0 11,4 П р и м е ч а н и е. 1, 2, 3 и 4

сертификат iso 9000
Почвы: серые и светло серые лесные легкосуглинистые, темно серые лесные, дерново подзолистые легкосуглинистые на покровных и моренных суглинках, на лессовидных суглинках, дерново подзолистые супесчаные и песчаные. Зернобобовые, фруктовые 0,6 Выгоничский То же Зернобобовые 0,5 Гордеевский Ландшафт: морено зандровые равнины с волнистым и плоским характером поверхности.

Ae. cylindrica regardless of crossing direction ,
Belarusskaya 12 × Lutescens 6747 regardless of crossing direction, the weight of 1000 grains Ae. comosa Belarusskaya 12 × Altayskaya 92 in direct crosses, Lutescens 6747 Í Ae. comosa Omskaya 19 in backcrosses the productive tillering in direct crosses Ae. cylindrica Omskaya 19 ×

Выявленные различия, по всей видимости, обусловлены сортовыми особенностями.
Повторность опыта 3 кратная в каждой — по 25 черенков . Математическую обработку данных выполняли по Б.А. Доспехову 11 трехфакторный дисперсионный анализ: фактор А, В и С — соответственно фенологическая фаза, местоположение черенка в побеге и субстрат . Результаты. Как оказалось, частота укоренения у черенков,

Пыльца однородная, во все годы сохраняла высокую фертильность 95 100 .
РАН «Фундаментальные основы управления биологическими ресурсами» в 2003 2005 годах мы отрабатывали методы интенсивного семенного размножения ирисов в условиях открытого грунта с использованием девяти синтетических регуляторов роста — гетероауксина, крезацина, фитона, а также новых ФАВ, синтезированных в

Чудо.При использованиипраймера OPE7 RAPD спектр у сортаСнегирь ,
ДНК — 1 мин при 72 °С число циклов — 36 предварительная денатурация — 5 мин при 94 °С заключительная элонгация — 10 мин при 72 °С. Все реакции выполняли в двух повторностях. Продукты амплификации разделяли электрофорезом в 1,7 агарозном геле high resolution, «Sigma», MetaPhor, «Cambrex», США в 1хТВЕ буфере с последующим окрашиванием бромистым этидием.

андатэль фруктовый лаваш сухофрукты купить
МС, а также наличия и частоты встречаемости аллелей микро сателлитов, общих для каждой из групп по D. Paetkau с соавт. 8 , показало рис. 1 , что смоленский тип бурой швицкой породы консолидирован и формирует массив, относительно обособленный от исходных пород, участвовавших в выведении. Вероятность отнесения индивидуума к собственной популяции на основании анализа аллельных профилей

Отметим, что в принципе оба метода дают положительные результаты,
Как было показано, каллус формировался с высокой частотой при концентрации 2,4 Д в среде 3 мг л, регенерационная способность была наибольшей при концентрации 3 мг л в среде для получения и 1 мг л ЂЂЂ в среде для пассирования каллуса. Частота регенерации растений из каллусных тканей, культивируемых на средах с высоким содержанием гормонов,

КОЕ мл табл. 3 . Через 7 нед различия в титрах стали более выраженными.
По видимому, это связано с разной динамикой использования указанных компонентов, что способствовало поддержанию достаточного питания клеток на протяжении всего срока хранения. 1. Динамика титра x10 9 КОЕ г клубеньковых бактерий сои Bradyrhizobium japonicum штамм 634б в проце ссе хранения при внесении оптимизирующих добавок в вермикулит

Нами разработан способ, позволяющий отбирать растения гречихи с высоким содержанием рутина в надземной массе по темно красной окраске стеблей и ветвей в фазу плодообразования 11 .
Экспериментальные данные обрабатывали методами статистического и корреляционного анализа по Б.А. Доспехову 10 . Внутрисортовая изменчивость содержания рутина у растений гречихи в зависимости от окраски стебля и ветвей в период плодообразования: I, II, III и IV — соответственно зеленые, зелено красные,

Whanger 8 , абсорбция селена происходит в тонком кишечнике несколько большую скорость транспорта обеспечивает 12 перстная кишка ,
II групп см. в разделе «Методика». , и Соответственно p 0,05,  p 0,01 и p 0,001. Содержание селена в мышечной ткани и внутренних органах животных опытных групп было достоверно выше, чем в контроле. Распределение селена по органам и тканям зависело от формы используемого соединения. Так, у свиней I и

террасная доска из лиственницы
По качеству зерна сорт Галина уступал сорту Московская 39. Сорта озимой пшеницы Галина и Немчиновская 24, включенные в Государственный реестр селекционных достижений, хорошо отзывались на средства химизации. Сорт Московская 39 за годы исследований 1995 2007 имел стабильную урожайность по предшественникам — однолетним и многолетним травам и высокие показатели качества зерна.

Испарение с поверхности усиков у сортов Орлус и Норд составляло в расчете на сырую массу соответственно 551 и 328,
Аксайский усатый 5 85,1 61,6 38,4 0,62 18,2 81,8 Мультик 85,8 57,4 42,6 0,74 18,5 81,5 Алла 81,3 53,9 46,1 0,86 23,5 76,5 УС П 98 388 84,3 58,0 42,0 0,72 16,3 83,7 С редуцированными прилистниками генотип af af st st Филби 86,0 57,3 42,8 0,75 23,5 76,5 Среднее по безлисточковым сортам 84,1 57,1 42,9 0,76 20,5 79,5

Амилаза, ед л: до введения 3339,30a192,43 4699,00a506,30 4617,60a871,01 3779,30a514,20 3 и сут 3528,60a288,65 4595,00a571,85 4880,00a427,73 2623,60a130,67 10 е сут 3792,60a276,80 4102,30a324,37 4354,00a932,30 3610,00a185,70
Гемоглобин, г л: до введения 121,40a3,85 109,69a4,51 116,27a5,42 117,84a4,78 3 и сут 123,20a3,85 114,90a4,37 117,58a4,50 120,63a4,28 10 е сут 124,28a4,95 125,80a4,22 129,96a4,20 116,84a2,42 Число эритроцитов, m1012 л: до введения 5,29a0,14 5,32a0,34 5,56a0,41 5,08a0,14 3 и сут 5,95a0,59 5,49a0,32 6,30a0,21 5,53a0,30 10 е сут 6,47a0,39 6,10a0,34 6,29a0,32 5,33a0,22

England , 20 — Milton Canada , 21 — Eritrospermum 609
Grain formation and ripening are the processes related to creation of an offspring generation out of the photosynthesis in leaves and other green plant organs. Premature defoliation, abscission by leaf eating insects, fungal diseases or experimental artificial deletion contribute to a stress and change in a quantitative relationship between producing plant organs and ones consuming assimilates,

По количеству незаменимых аминокислот значительных различий с контролем не отмечали.
Птицу выращивали без разделения по полу с соблюдением технологических условий содержания, кормили вволю сухими полнорационными кормами по нормам питательной ценности, рекомендованным для указанного кросса 8 . В корм птицы из опытной группы добавляли исследуемый нанокомплекс в дозе 30 г т. Кормовые антибиотики не использовали.

строительство деревянных домов область под ключ проекты
Содержание гемоглобина у молодняка норок также находилось в пределах физиологической нормы от 150,2±11,3 до 156,3±24,1 г л , к концу опыта наблюдалась тенденция к увеличению этого показателя. К окончанию эксперимента во всех опытных группах возрастало число тромбоцитов наиболее значительно — у особей из

Глутаминовая кислота 187,21±6,56 201,80±7,06 Глутамин 853,52±29,88 946,40±33,14 &alpha
Полученные данные обрабатывали статистически 8 .  Результаты . Гематологические и иммунологические показатели у быков и коров в основном соответствовали нормативам, свойственным породе, хотя содержание &alpha и &gamma глобулинов было ниже, а &beta глобулинов — выше нормы. Быки производители, получавшие рацион,

Neutrophils, 63,50±6,70 62,60±1,50 67,90±1,52 69,30±4,70 65,10±3,50 65,40±6,24 60,80±9,20 68,80±9,07
III respectively,  9,38 ± 0,98 and 8,58 ± 0,88 1012 l, which exceeded control by 13,8 and 4,1 .The content of hemoglobin in young minks also corresponded the physiological norm from 150,2 ± 11,3 to 156,3 ± 24,1 g l , and the trend to its raise was observed by the end of experiment. The number of platelets increased in all experimental groups by the end of the experiment the highest levels groups

ПДК для плодов и ягод 14 0,400 0,500 10,000 5,000 50,000
Поступление микроэлементов в растения может быть пассивным по градиенту концентрации или активным против градиента концентрации с затратой энергии , что предполагает существование двух главных факторов формирования элементного химического состава растений — генетического и экологического. Доля каждого варьирует в зависимости от изменений условий среды.

Все испытанные мембраны, обладая 100 селективностью по белку,
Эффективность мембран оценивали по кратности концентрирования препарата измеряя объем фильтрата в мерном сосуде на выходе из ультрафильтрационной установки , величине и стабильности биологической активности вируса в концентрате ВСМ, степени очистки материала по белку, скорости фильтрации, селективности и технологичности.

Создание сайта инструкция своими руками
Taq polymerase, 1 х buffer from the corresponding set “Dialat Ltd.”, Russia and 100 ng genomic DNA. The thermocycler amplifier GeneAmp PCR System2700 “Applied Biosystems”, USA was operated under the regime: denaturation 30 s at 94 °C, primer annealing – 45 s at 37 °C number of cycles 36 DNA synthesis 1 min at 72 °C,

High intensive 3,48 6,82 6,59 5,63 42,8 43,9 55,3 47,3 12,9 13,7 14,3 13,6
Year 2005 was less favorable due to snow mold, other diseases and pests in 2005, crop yields in all the varieties amounted to 3,01 3,63 t ha with small but significant differences depending on cultivation technology. Weight of 1000 grains varied by years the best results were obtained in 2007 50,6 59,1g.

С 3 й по 15 ю мин после начала реакции с интервалом 3 мин регистрировали выделяемый объем
СОД оценивали по модифицированной методике 5, 6 . Растительный материал измельчали в ступке с 25 мл фосфатного буферного раствора pH 7,8 , центрифугировали 7000 об мин в течение 15 мин , отделяли надосадочную жидкость в дальнейшем — экстракт СОД . Анализ проводили методом фиксированного времени. Реакционная среда общий объем — 2,5 мл содержала фосфатный буфер 50 мМ,

По нашему мнению, это связано с проявлением защитных свойств плаценты на ранней стадии внутриутробного развития.
Кровь, мкг мл 0,16± 0,14 0,64± 0,13 0,85± 0,11 1,07± 0,37 1,56± 0,38 1,36± 0,27 0,89± 0,13 1,08± 0,21 0,96± 0,18 Плацента, мкг г 0,98± 0,12 0,63± 0,11 0,58± 0,14 0,28± 0,09 0,52± 0,15 0,64± 0,12 0,55± 0,18 0,41± 0,04 0,35± 0,11 Предплоды плоды Мышечная ткань, мкг г 0,29± 0,10 0,84± 9,21 0,76± 0,07 0,05± 0,45 1,39± 0,37 1,27± 0,25 1,05± 0,25 1,07± 0,12

Как известно, в условиях постоянно варьирующих факторов внешней среды и конкурентных взаимоотношений всегда наблюдается та или иная степень изменчивости внутри сорта как результат морфофизиологических приспособительных реакций 9 11 ,
В начале вегетации в фазу всходов посев по параметрам площади листовой поверхности и сухой массе был однороден и характеризовался относительно невысокими средними значениями показателей табл. 1 . 1. Средние значения Х ± х , стандартное отклонение d и коэффициент вариации Cv морфологических показателей у растений яровой пшеницы сорта

расходные материалы аксессуары для клининга
США 2,4±0,1 2,7±0,1 4,2±0,1 12,9 16,4 9,2 3,3±0,2 2,9±0,2 4,6±0,2 5,1±0,3 15,6 17,7 16,6 17,9 веточек общее 5419 4877 14762 11714 Турция Турция США США 15,1±8,0 29,0±0,9 16,9 10,5 20,0±2,2 14,8±1,5 30,3±1,6 33,6±1,6 31,7 32,9 16,2 14,0 колосков в мутовке 4763 4742 12216 10509 Алжир Алжир Индия Индия 21,9±1,6 79,5±4,3 22,8 17,0 37,8±4,7 21,3±2,1 49,2±11,8 84,1±5,5 39,7 30,1 72,0 20,6 зерен в метелке 11404 4742 13906 7936

МГМ используют для решения трех основных задач — выявления специфических характеристик популяционно генетических структур,
Исследования особенностей морфогенетических процессов при спонтанной генетической трансформации видов, анализ причин возникновения этого явления в эволюции и его экологических последствий могут способствовать выяснению ряда вопросов геномной эволюции, влияния на эволюционные события факторов экологического стресса,

Аминокислота, : лизин 1,550± 0,132 1,730± 0,077 2,010± 0,089 1,510± 0,081 1,730± 0,078 1,510± 0,111 метионин 0,240± 0,035 0,350± 0,023 0,430± 0,027 0,250± 0,029 0,340± 0,024 0,270± 0,032 цистеин 0,970± 0,035 0,880± 0,025 0,870± 0,011 0,920± 0,017 0,890± 0,036 0,880± 0,035 гистидин 0,560± 0,054 0,590± 0,027 0,710± 0,034 0,540± 0,030 0,580± 0,035 0,530± 0,043 аргинин 0,120± 0,044 0,270± 0,046 0,480± 0,060 0,090± 0,027 0,250± 0,065 0,270± 0,048 треонин 0,150± 0,036 0,300± 0,030 0,410± 0,038 0,140± 0,036 0,290± 0,032 0,220± 0,032 серин 0,080± 0,039 0,260± 0,035 0,360± 0,053 0,080± 0,021 0,220± 0,047 0,180± 0,033 пролин 0,680± 0,119 0,310± 0,101 0,420± 0,155 0,690± 0,111 0,380± 0,083 0,600± 0,121 глицин 0,530± 0,035 0,180± 0,030 0,140± 0,043 0,500± 0,042 0,200± 0,058 0,370± 0,037 валин 0,800± 0,131 2,220± 0,025 2,200± 0,188 0,910± 0,111 1,970± 0,290 1,550± 0,125 изолейцин 0,650± 0,046 0,120± 0,046 0,200± 0,068 0,550± 0,055 0,200± 0,090 0,340± 0,048 лейцин 1,020± 0,097 0,970± 0,051 1,180± 0,085 0,950± 0,077 0,960± 0,068 0,090± 0,090 тирозин 0,030± 0,009 0,070± 0,007 0,070± 0,016 0,030± 0,004 0,060± 0,015 0,070± 0,011 фенил аланин 0,150± 0,044 0,190± 0,031 0,320± 0,037 0,100± 0,025 0,200± 0,040 0,200± 0,033
Корневая система растений молодых, 2004 год среднего возраста, 2004 год среднего возраста, 2005 год Аминокислота, : лизин 0,820±0,044 0,340±0,067 0,350±0,043 0,760±0,177 метионин 0,400±0,012 0,060±0,009 0,040±0,011 0,080±0,047 цистеин 0,290±0,015 0,820±0,020 0,490±0,016 0,790±0,089 гистидин 0,300±0,020 0,100±0,025 0,090±0,017 0,240±0,073 аргинин 1,120±0,030 0,640±0,039 0,630±0,020 0,420±0,065 треонин 0,650±0,018 0,240±0,023 0,230±0,013 0,120±0,023 серин 0,790±0,021 0,370±0,023 0,380±0,016 0,140±0,021 пролин 2,280±0,049 1,740±0,059 1,560±0,087 0,890±0,122 глицин 1,180±0,008 0,710±0,023 0,670±0,018 0,520±0,034 валин 1,130±0,035 0,970±0,070 0,990±0,094 1,620±0,170 изолейцин 0,120±0,014 0,230±0,042 0,230±0,044 0,190±0,028 лейцин 0,550±0,032 0,230±0,050 0,190±0,034 0,370±0,139 тирозин 0,400±0,007 0,110±0,011 0,100±0,009 0,140±0,021 фенилаланин 0,850±0,020 0,430±0,031 0,410±0,018 0,280±0,029

Izumrud standard in accelerated development, number of lateral branches of the 2 th order,
The variants’ assessment was performed on the basis of phenological observations using the state method of crops testing 8 . Rutin was identified with 1H NMR spectra on the spectrometer Bruker AC 250 250,13 MHz for 1H “Bruker”, Germany in CDCl3 and acetone d6. Mass spectra were obtained using the device

VI 70,00±4,15 75,46±1,53 8,39±0,19 VII 71,25±5,61 76,40±1,90 8,45±0,33 20 е   с у т   п о с л е   о п о р о с а
Р 0,05 у лактирующих особей — на 7,70 14,70 Р 0,05 и 17,90 Р 0,05 см. рис. . Содержание иммуноглобулинов в сыворотке крови свиноматок в разные сроки супоросности и лактации в зависимости от количества аскорбиновой кислоты А и свекловичной патоки Б в рационах: а, б, в, г, д, е, ж — соответственно I контроль ,

молодежная мужская брендовая одежда оптом в москве
Комбикорма содержали 10 подсолнечного шрота до 21 х сут выращивания и 20 — с 22 х сут до убоя 37 е сут . Учитывали сохранность поголовья, живую массу бройлеров в возрасте 1, 21 и 37 сут, потребление корма за период выращивания в расчете на 1 гол., затраты корма на 1 кг прироста живой массы на окончание опыта ,

До облучения контроль 2,23±0,21 2,18±0,13 2,18±0,13
Са 2 в тромбоцитах и лимфоцитах необлученных овец показало, что его значения составляли в среднем соответственно 2,42±0,25 и 2,33±0,31 мкг мг белка. После внешнего &gamma облучения овец общее содержание Са 2 в тромбоцитах практически не отличалось от исходного независимо от срока исследования и дозы воздействия табл.

Московского зоопарка Волоколамский р н, Московская обл.
Площадь гнездовой камеры в берлоге составляла около 2 м 2 . Сверху берлоги делали земляную насыпь высотой 1,5 м. В убежище устанавливали видеокамеру и электротермометр, с помощью которого измеряли температуру воздуха в норе и снаружи. Видеоинформация круглосуточно регистрировалась компьютером, расположенным в помещении,

Оптимальная для нетто фотосинтеза освещенность у наиболее светолюбивого из исследуемых видов
При достаточной выравненности материала и указанной точности измерений экспериментальные модели в пределах оптимальных зон факторов имеют погрешность до 5, при отклонении от них ЂЂЂ до 15 . Силу влияния различной интенсивности фактора на нетто фото синтез интактных растений рассчитывали по тангенсу угла наклона на интересующем участке температурных и световых кривых,

Среднее 7 9 4,30±0,33 39,00±1,52 56,70±1,76 10 32 3,00±0,44 39,00±1,64 58,00±0,73 11 32 4,00±0,46 39,00±0,92 57,00±0,89 12 32 3,00±0,66 42,00±1,23 55,00±1,32
Альфа ритм частота 8 12 кол с, амплитуда 20 60 мкВ см. рис., в наблюдали у животных в спокойном бодрствующем состоянии, реже в состоянии активного бодрствования. Для амплитуды альфа ритма характерна модуляция, запись имеет вид веретена, типичного только для альфа ритма: сначала отмечается волна с низкой амплитудой,

Enhanced Avian Reverse Transcriptase PCR Kit «Sigma
Catctctggctgggttcttc 3&prime rv 5&prime Aattgcttcggaaccacaag 3&prime 59 115 XM 420348 fw 5&prime gagctgccaaaaactgcttc 3&prime rv 5&prime agatcagcctcttgcaccat 3&prime 59 142 NM 001031126 fw 5&prime gcagcagaaagagcagagg 3&prime rv 5&prime tcgttagcctcagtccacct 3&prime 59 103 XM 420350 fw 5&prime Aacgacctggagaagcagaa 3&prime rv 5&prime

 [1]  [2]  [3]  [4]  [5]  [6]