Легко и среднесуглинистые 0,200 0,178 0,96 0,100 0,037 0,87 0,080 0,024 0,64
Cs хорошо описывается совокупностью экспонент, каждая из которых аппроксимирует изменение этого показателя в определенный период времени 3 . Анализ данных, характеризующих изменение КП, показывает, что для разработки регрессионных моделей целесообразно выделить три временных периода. В течение 1 го 1987 1991 годы протекали интенсивные процессы перераспределения и фиксации 137

Так, содержание витамина С аскорбиновой кислоты в опыте увеличилось соответственно на 38,8 и 25,3 по сравнению с контролем,
Наиболее быстрое формирование ярусов наблюдали у растений гибридов Виллина и Валентина, что сопровождалось ингибированием роста листовых пластинок предыдущих ярусов у гибридов Миракл и Татьяна развитие листовых пластинок предыдущих ярусов продолжалось см. рис. . На поздних стадиях онтогенеза морфометрические показатели растений в опыте и контроле различались меньше,

Bioindustry innovative solutions for vosproizvedstva,
For effective information support of agriculture the awards received were a silver medal and diploma and a bronze medal and diploma for the development of an automated information system Nutrition and feeding farm animals . 05.10.2011 State of the World s Animal Genetic Resources for Food and Agriculture is published by the

Интенсивность реализации рефлекса молокоотдачи во многом определяется индивидуальными особенностями коров,
Общая продолжительность доения составила в среднем 276,4 с. Резкое повышение ОСК см. рис. 1, точка D наблюдали через 68,5 с от начала доения. ОСК достигала наибольших значений через 157 с от начала доения или через 88,5 с от начала резкого подъема ОСК . Продолжительность периода повышенных значений

В первом варианте оно имело вид либо 1:1, либо 1:2,
При анализе гибридов учитывали число растений с разным типом метелки, число голых и пленчатых зерен в метелках промежуточного типа без учета зерна промежуточного типа , массу голого и пленчатого зерна с растения. Уборку растений F 2 и F 3 осуществляли комбайнами Hege 125 Австрия . Благоприятные климатические условия для развития растений овса сложились в 2003 году.

ЂЂЂ побеги соответственно 1 го, 2 го и 3 го порядка.
Краевые 9,1 9,3 11,7 14,3 Средние 8,0 6,7 9,7 11,7 Внутренние 5,0 5,0 8,3 10,0 В среднем по группе 8,1 7,0 9,9 12,0 В среднем для побегов порядка 9,3 8,6 10,8 13,9 Средние Краевые 11,5 10,8 13,2 16,3 Средние Средние 9,3 8,3 11,2 12,9 Средние Внутренние 6,9 6,7 9,0 11,4 П р и м е ч а н и е. 1, 2, 3 и 4

Ae. cylindrica regardless of crossing direction ,
Belarusskaya 12 × Lutescens 6747 regardless of crossing direction, the weight of 1000 grains Ae. comosa Belarusskaya 12 × Altayskaya 92 in direct crosses, Lutescens 6747 Í Ae. comosa Omskaya 19 in backcrosses the productive tillering in direct crosses Ae. cylindrica Omskaya 19 ×

Масса яйца — один из основных показателей яичной продуктивности.
Активированный промотор заставляет экспрессироваться ген бычьего гормона роста. У трансгенных по этой конструкции перепелов происходит синтез указанного гормона, что продемонстрировано нами ранее 5, 11 . Рис. 1 . Физическая карта плазмиды pMTbGH 2 x att указаны сайты рестрикции эндонуклеазами , использованной в качестве генной конструкции при получении генетически модифицированных перепелов описание см.

МС у скота созданных типов позволяет проследить интродукцию пород,
МС, а также наличия и частоты встречаемости аллелей микро сателлитов, общих для каждой из групп по D. Paetkau с соавт. 8 , показало рис. 1 , что смоленский тип бурой швицкой породы консолидирован и формирует массив, относительно обособленный от исходных пород, участвовавших в выведении. Вероятность отнесения индивидуума к собственной популяции на основании анализа аллельных профилей

шапка капюшон оптом
Как было показано, каллус формировался с высокой частотой при концентрации 2,4 Д в среде 3 мг л, регенерационная способность была наибольшей при концентрации 3 мг л в среде для получения и 1 мг л ЂЂЂ в среде для пассирования каллуса. Частота регенерации растений из каллусных тканей, культивируемых на средах с высоким содержанием гормонов,

КОЕ мл табл. 3 . Через 7 нед различия в титрах стали более выраженными.
По видимому, это связано с разной динамикой использования указанных компонентов, что способствовало поддержанию достаточного питания клеток на протяжении всего срока хранения. 1. Динамика титра x10 9 КОЕ г клубеньковых бактерий сои Bradyrhizobium japonicum штамм 634б в проце ссе хранения при внесении оптимизирующих добавок в вермикулит

Whanger 8 , абсорбция селена происходит в тонком кишечнике несколько большую скорость транспорта обеспечивает 12 перстная кишка ,
II групп см. в разделе «Методика». , и Соответственно p 0,05,  p 0,01 и p 0,001. Содержание селена в мышечной ткани и внутренних органах животных опытных групп было достоверно выше, чем в контроле. Распределение селена по органам и тканям зависело от формы используемого соединения. Так, у свиней I и

Б, среднее по породам прекос и романовская, n = 150 ,
Al 0,055±0,004 1,6 0,111±0,005 1,9 0,176±0,009 8,5 0,415±0,013 6,7 Gl 1 – – – – 0,112±0,008 5,4 – – Gl 2 – – – – 0,095±0,006 4,6 – – Pp 0,047±0,002 1,4 0,080±0,004 1,4 0,077±0,005 3,7 0,102±0,009 2,6 Ig 1 0,097±0,003 – 2,9 – – – – – – – – – 0,237±0,015 3,8 Ig 2 0,502±0,020 8,1 прочие 0,026±0,002 0,8 – – – – 0,109±0,005 1,7

Амилаза, ед л: до введения 3339,30a192,43 4699,00a506,30 4617,60a871,01 3779,30a514,20 3 и сут 3528,60a288,65 4595,00a571,85 4880,00a427,73 2623,60a130,67 10 е сут 3792,60a276,80 4102,30a324,37 4354,00a932,30 3610,00a185,70
Гемоглобин, г л: до введения 121,40a3,85 109,69a4,51 116,27a5,42 117,84a4,78 3 и сут 123,20a3,85 114,90a4,37 117,58a4,50 120,63a4,28 10 е сут 124,28a4,95 125,80a4,22 129,96a4,20 116,84a2,42 Число эритроцитов, m1012 л: до введения 5,29a0,14 5,32a0,34 5,56a0,41 5,08a0,14 3 и сут 5,95a0,59 5,49a0,32 6,30a0,21 5,53a0,30 10 е сут 6,47a0,39 6,10a0,34 6,29a0,32 5,33a0,22

купить печь камин нева
Grain formation and ripening are the processes related to creation of an offspring generation out of the photosynthesis in leaves and other green plant organs. Premature defoliation, abscission by leaf eating insects, fungal diseases or experimental artificial deletion contribute to a stress and change in a quantitative relationship between producing plant organs and ones consuming assimilates,

По количеству незаменимых аминокислот значительных различий с контролем не отмечали.
Птицу выращивали без разделения по полу с соблюдением технологических условий содержания, кормили вволю сухими полнорационными кормами по нормам питательной ценности, рекомендованным для указанного кросса 8 . В корм птицы из опытной группы добавляли исследуемый нанокомплекс в дозе 30 г т. Кормовые антибиотики не использовали.

Нейтрофилы, 63,50±6,70 62,60±1,50 67,90±1,52 69,30±4,70 65,10±3,50 65,40±6,24 60,80±9,20 68,80±9,07
Содержание гемоглобина у молодняка норок также находилось в пределах физиологической нормы от 150,2±11,3 до 156,3±24,1 г л , к концу опыта наблюдалась тенденция к увеличению этого показателя. К окончанию эксперимента во всех опытных группах возрастало число тромбоцитов наиболее значительно — у особей из

Глутаминовая кислота 187,21±6,56 201,80±7,06 Глутамин 853,52±29,88 946,40±33,14 &alpha
Полученные данные обрабатывали статистически 8 .  Результаты . Гематологические и иммунологические показатели у быков и коров в основном соответствовали нормативам, свойственным породе, хотя содержание &alpha и &gamma глобулинов было ниже, а &beta глобулинов — выше нормы. Быки производители, получавшие рацион,

ПДК для плодов и ягод 14 0,400 0,500 10,000 5,000 50,000
Поступление микроэлементов в растения может быть пассивным по градиенту концентрации или активным против градиента концентрации с затратой энергии , что предполагает существование двух главных факторов формирования элементного химического состава растений — генетического и экологического. Доля каждого варьирует в зависимости от изменений условий среды.

Atoll A-460E A-550 MAX
Taq polymerase, 1 х buffer from the corresponding set “Dialat Ltd.”, Russia and 100 ng genomic DNA. The thermocycler amplifier GeneAmp PCR System2700 “Applied Biosystems”, USA was operated under the regime: denaturation 30 s at 94 °C, primer annealing – 45 s at 37 °C number of cycles 36 DNA synthesis 1 min at 72 °C,

По нашему мнению, это связано с проявлением защитных свойств плаценты на ранней стадии внутриутробного развития.
Кровь, мкг мл 0,16± 0,14 0,64± 0,13 0,85± 0,11 1,07± 0,37 1,56± 0,38 1,36± 0,27 0,89± 0,13 1,08± 0,21 0,96± 0,18 Плацента, мкг г 0,98± 0,12 0,63± 0,11 0,58± 0,14 0,28± 0,09 0,52± 0,15 0,64± 0,12 0,55± 0,18 0,41± 0,04 0,35± 0,11 Предплоды плоды Мышечная ткань, мкг г 0,29± 0,10 0,84± 9,21 0,76± 0,07 0,05± 0,45 1,39± 0,37 1,27± 0,25 1,05± 0,25 1,07± 0,12

По числу колосков в мутовке у овса посевного размах варьирования был выше,
США 2,4±0,1 2,7±0,1 4,2±0,1 12,9 16,4 9,2 3,3±0,2 2,9±0,2 4,6±0,2 5,1±0,3 15,6 17,7 16,6 17,9 веточек общее 5419 4877 14762 11714 Турция Турция США США 15,1±8,0 29,0±0,9 16,9 10,5 20,0±2,2 14,8±1,5 30,3±1,6 33,6±1,6 31,7 32,9 16,2 14,0 колосков в мутовке 4763 4742 12216 10509 Алжир Алжир Индия Индия 21,9±1,6 79,5±4,3 22,8 17,0 37,8±4,7 21,3±2,1 49,2±11,8 84,1±5,5 39,7 30,1 72,0 20,6 зерен в метелке 11404 4742 13906 7936

Аминокислота, : лизин 1,550± 0,132 1,730± 0,077 2,010± 0,089 1,510± 0,081 1,730± 0,078 1,510± 0,111 метионин 0,240± 0,035 0,350± 0,023 0,430± 0,027 0,250± 0,029 0,340± 0,024 0,270± 0,032 цистеин 0,970± 0,035 0,880± 0,025 0,870± 0,011 0,920± 0,017 0,890± 0,036 0,880± 0,035 гистидин 0,560± 0,054 0,590± 0,027 0,710± 0,034 0,540± 0,030 0,580± 0,035 0,530± 0,043 аргинин 0,120± 0,044 0,270± 0,046 0,480± 0,060 0,090± 0,027 0,250± 0,065 0,270± 0,048 треонин 0,150± 0,036 0,300± 0,030 0,410± 0,038 0,140± 0,036 0,290± 0,032 0,220± 0,032 серин 0,080± 0,039 0,260± 0,035 0,360± 0,053 0,080± 0,021 0,220± 0,047 0,180± 0,033 пролин 0,680± 0,119 0,310± 0,101 0,420± 0,155 0,690± 0,111 0,380± 0,083 0,600± 0,121 глицин 0,530± 0,035 0,180± 0,030 0,140± 0,043 0,500± 0,042 0,200± 0,058 0,370± 0,037 валин 0,800± 0,131 2,220± 0,025 2,200± 0,188 0,910± 0,111 1,970± 0,290 1,550± 0,125 изолейцин 0,650± 0,046 0,120± 0,046 0,200± 0,068 0,550± 0,055 0,200± 0,090 0,340± 0,048 лейцин 1,020± 0,097 0,970± 0,051 1,180± 0,085 0,950± 0,077 0,960± 0,068 0,090± 0,090 тирозин 0,030± 0,009 0,070± 0,007 0,070± 0,016 0,030± 0,004 0,060± 0,015 0,070± 0,011 фенил аланин 0,150± 0,044 0,190± 0,031 0,320± 0,037 0,100± 0,025 0,200± 0,040 0,200± 0,033
Корневая система растений молодых, 2004 год среднего возраста, 2004 год среднего возраста, 2005 год Аминокислота, : лизин 0,820±0,044 0,340±0,067 0,350±0,043 0,760±0,177 метионин 0,400±0,012 0,060±0,009 0,040±0,011 0,080±0,047 цистеин 0,290±0,015 0,820±0,020 0,490±0,016 0,790±0,089 гистидин 0,300±0,020 0,100±0,025 0,090±0,017 0,240±0,073 аргинин 1,120±0,030 0,640±0,039 0,630±0,020 0,420±0,065 треонин 0,650±0,018 0,240±0,023 0,230±0,013 0,120±0,023 серин 0,790±0,021 0,370±0,023 0,380±0,016 0,140±0,021 пролин 2,280±0,049 1,740±0,059 1,560±0,087 0,890±0,122 глицин 1,180±0,008 0,710±0,023 0,670±0,018 0,520±0,034 валин 1,130±0,035 0,970±0,070 0,990±0,094 1,620±0,170 изолейцин 0,120±0,014 0,230±0,042 0,230±0,044 0,190±0,028 лейцин 0,550±0,032 0,230±0,050 0,190±0,034 0,370±0,139 тирозин 0,400±0,007 0,110±0,011 0,100±0,009 0,140±0,021 фенилаланин 0,850±0,020 0,430±0,031 0,410±0,018 0,280±0,029

Izumrud standard in accelerated development, number of lateral branches of the 2 th order,
The variants’ assessment was performed on the basis of phenological observations using the state method of crops testing 8 . Rutin was identified with 1H NMR spectra on the spectrometer Bruker AC 250 250,13 MHz for 1H “Bruker”, Germany in CDCl3 and acetone d6. Mass spectra were obtained using the device

насос трехплунжерный типа нк
Р 0,05 у лактирующих особей — на 7,70 14,70 Р 0,05 и 17,90 Р 0,05 см. рис. . Содержание иммуноглобулинов в сыворотке крови свиноматок в разные сроки супоросности и лактации в зависимости от количества аскорбиновой кислоты А и свекловичной патоки Б в рационах: а, б, в, г, д, е, ж — соответственно I контроль ,

I группа контроль II группа опыт Сохранность, 94,3 97,1
Комбикорма содержали 10 подсолнечного шрота до 21 х сут выращивания и 20 — с 22 х сут до убоя 37 е сут . Учитывали сохранность поголовья, живую массу бройлеров в возрасте 1, 21 и 37 сут, потребление корма за период выращивания в расчете на 1 гол., затраты корма на 1 кг прироста живой массы на окончание опыта ,

До облучения контроль 2,23±0,21 2,18±0,13 2,18±0,13
Са 2 в тромбоцитах и лимфоцитах необлученных овец показало, что его значения составляли в среднем соответственно 2,42±0,25 и 2,33±0,31 мкг мг белка. После внешнего &gamma облучения овец общее содержание Са 2 в тромбоцитах практически не отличалось от исходного независимо от срока исследования и дозы воздействия табл.

Московского зоопарка Волоколамский р н, Московская обл.
Площадь гнездовой камеры в берлоге составляла около 2 м 2 . Сверху берлоги делали земляную насыпь высотой 1,5 м. В убежище устанавливали видеокамеру и электротермометр, с помощью которого измеряли температуру воздуха в норе и снаружи. Видеоинформация круглосуточно регистрировалась компьютером, расположенным в помещении,

Среднее 7 9 4,30±0,33 39,00±1,52 56,70±1,76 10 32 3,00±0,44 39,00±1,64 58,00±0,73 11 32 4,00±0,46 39,00±0,92 57,00±0,89 12 32 3,00±0,66 42,00±1,23 55,00±1,32
Альфа ритм частота 8 12 кол с, амплитуда 20 60 мкВ см. рис., в наблюдали у животных в спокойном бодрствующем состоянии, реже в состоянии активного бодрствования. Для амплитуды альфа ритма характерна модуляция, запись имеет вид веретена, типичного только для альфа ритма: сначала отмечается волна с низкой амплитудой,

купить детское автокресло 0
Урожайность гороха посевного сорта Татьяна при использовании микробиологических препаратов и минеральных удобрений Орловская обл., 2003 2005 годы Вариант Урожайность, т га Прибавка к контролю, Контроль 2,15 Бисолбисан 2,67 24,2 Бисолбимикс 2,89 34,4 N 22,5 P 30 K 45 2,66 23,7 N 22,5 P 30 K 45 бисолбисан 2,80 30,2

Enhanced Avian Reverse Transcriptase PCR Kit «Sigma
Catctctggctgggttcttc 3&prime rv 5&prime Aattgcttcggaaccacaag 3&prime 59 115 XM 420348 fw 5&prime gagctgccaaaaactgcttc 3&prime rv 5&prime agatcagcctcttgcaccat 3&prime 59 142 NM 001031126 fw 5&prime gcagcagaaagagcagagg 3&prime rv 5&prime tcgttagcctcagtccacct 3&prime 59 103 XM 420350 fw 5&prime Aacgacctggagaagcagaa 3&prime rv 5&prime

ЛЭК 3 5 2,95±0,05 ТБ 3 5 2,79±0,03 Диплоидные: Т3Э 4 5 2,19±0,16
Исходный титр вируса lg ТЦД 50 мл при заражении составлял 1,5 3,0. Вирус культивировали при температуре 37 °С в стационарных условиях. Инфекционную активность РС вируса в культуре клеток определяли по цитопатическому действию ЦПД титрованием микро и пробирочным методом, инфекционный титр рассчитывали по

Оценка действия температурного фактора на урожай зерна показала,
В о з д у ш н о с у х а я м а с с а, г 0 10 1,02± 0,01 1,05± 0,02 1,02± 0,01 — — 0 20 0,53± 0,01 0,53± 0,01 0,53± 0,01 — — 0 25 0,44± 0,01 0,55± 0,01 0,61± 0,01 — — 220 10 1,03± 0,02 0,87± 0,01 0,85± 0,01 — — 470 10 1,05± 0,01 0,87± 0,01 0,98± 0,01 — — 220 20 0,75± 0,02 0,40± 0,01 0,40± 0,01 — — 470 20 0,76± 0,01 0,44± 0,01 0,48± 0,01 — — 220 25 0,33± 0,01 0,40± 0,01 0,53± 0,01 — — 470 25 0,32± 0,01 0,48± 0,01 0,57± 0,01 — —

Измайловского парка превышало минимальное 4 мг кг более чем в 60,0 раза.
Для абсорбции ртути внутренняя поверхность графитовой печи атомизатора спектрометра предварительно покрывается слоем высокодисперсного палладия. Результаты . Вода из трех водоемов, на которых были отловлены утки, существенно различалась по содержанию поллютантов табл. 1 . Наибольшим содержанием Pb характеризовались водоемы

индивидуальный инструктор
The number of root nodules and nitrogen fixation activity were determined in 10 15 plants from each line in the beginning of flowering using acetylene method 16 on the gas chromatograph devise Tsvet 500 Russia . During maturation, 10 15 plants from the same plots were evaluated for productivity characteristics:

Так, содержание главных казеиновых фракций &alpha s 1 и &beta в молозиве составило соответственно 0,891 и 0,777 г 100 мл,
Содержание в молозиве после отела в молоке через 24 ч на 3 4 е сут на 5 6 е сут г 100 мл г 100 мл г 100 мл г 100 мл Об щий 14,421±0,041 100 5,193±0,096 100 3,387±0,047 100 3,328±0,053 100 Казе ины: 2,755±0,046 19,1 2,671±0,051 51,4 2,664±0,048 78,7 2,613±0,044 78,5 F 0,044±0,004 0,3 0,043±0,004 0,8 0,046±0,004 1,4 0,048±0,008 1,4 &alpha s´ 0,135±0,009 0,9 0,124±0,010 2,4 0,128±0,010 3,8 0,117±0,015 3,5 &alpha s 0 0,201±0,009 1,4 0,183±0,011 3,5 0,203±0,013 6,0 0,189±0,006 5,7 &alpha s 1 0,891±0,025 6,2 0,898±0,029 17,3 0,883±0,022 26,1 0,844±0,022 25,4 &alpha s 2 0,280±0,019 1,9 0,290±0,020 5,6 0,274±0,015 8,1 0,230±0,009 6,9 &beta 0,777±0,019 5,4 0,733±0,025 14,1 0,714±0,024 21,1 0,796±0,018 23,9 &kappa 0,230±0,011 1,6 0,230±0,011 4,4 0,228±0,013 6,7 0,232±0,010 7,0 &gamma 0,111±0,009 0,8 0,091±0,006 1,8 0,099±0,008 2,9 0,076±0,004 2,3 s 0,087±0,008 0,6 0,079±0,005 1,5 0,089±0,006 2,6 0,081±0,007 2,4

Ростовской области степень загрязнения зерна кукурузы фузариотоксинами оставалась столь же значительной 34 образца из 36 .
Ю ж н ы й ф е д е р а л ь н ы й о к р у г 2002 год 51 47 47 9 — — 37 — — — 10 — — — — — — 2003 год 38 34 34 6 2 4 27 — — — 2 — 1 — 3 — 1 2004 2005 годы 36 34 31 19 7 — 12 3 — — 12 — 3 — — 4 — З е р н о р и с а К р а с н о д а р с к и й к р а й 2002 год 15 12 2 12 — — — 10 — — 2 — — — — — — 2003 год 7 6 4 6 1 4 — 1 — — 1 — — 1 2 — 1

L — расстояние между опорами, на которых расположена исследуемая кость
У собак под общей анестезией провели остеотомию правой большеберцовой кости под углом 12° к длинной оси косой перелом и иммобилизировали отломки посредством двух циркулярно наложенных на диафиз кости стягивающих полос авторской конструкции 7 левая большеберцовая кость служила контролем . После операции животным был назначен курс общей послеоперационной терапии,

ДВ 47 4 I 8,7 0,70 II 29,6 1,90 6,2 III 42,8 3,50 3,8
Приморская 301 5,3 12,8 7,5 7,8 2,5 Приморская 81 6,1 12,0 5,9 7,1 1,0 Приморская 69 6,8 13,2 6,4 6,6 0,2 Приморская 51 7,7 14,1 6,4 7,9 0,3 Приморская 529 5,2 16,1 10,9 7,1 1,9 Результаты. У сортов сои ввиду их биологических особенностей реакция на действие стимуляторов роста растений различалась.

очистные сооружения для автомоек
Реакционную смесь инкубировали на кипящей водяной бане в течение 30 мин, фильтровали и измеряли оптическую плотность фильтрата при длине волны 532 нм. Контролем служила среда выделения с реагентом. Концентрацию МДА рассчитывали в микромолях на 1 г сырой массы по молярной экстинкции 11 : С = D el, где

ОСК перед доением по величине разового удоя половины вымени
Объем крови в расчете на 1 л молока, л 1 2 11 я 2,74±0,09 2,85±0,08 682±17 2 2 27 я 2,92±0,07 2,82±0,09 740±20 5 5 13 я 2,70±0,06 3,06±0,17 634±36 6 4 20 я 4,32±0,10 4,20±0,24 751±37 7 4 17 я 2,97±0,16 3,06±0,06 723±40 11 4 18 я 3,45±0,12 4,06±0,12 622±31 12 3 9 я 2,40±0,10 3,09±0,11 549±23 13 2 17 я 2,52±0,14 2,95±0,05 628±20 14 2 27 я 1,93±0,03 1,70±0,12 830±72

Zn на фоне его критического содержания в почве был выше по сравнению с незагрязненными вариантами в 5,5 6,1 раза.
Cd 28,0 272 27,2 17,8 0,39 Pb 10,4 101 12,4 8,4 0,48 NPK Pb 24,6 239 29,0 19,2 0,47 NPK навоз Pb 28,1 273 30,4 19,9 0,43 Zn 10,5 102 13,0 8,9 0,50 NPK Zn 24,4 237 28,1 19,0 0,46 NPK навоз Zn 27,8 270 30,3 20,4 0,43 НСР05 3,2 П р и м е ч а н и е. Описание использованных фонов по вариантам опыта см. в разделе «Методика».

СО2 в атмосфере, способны положительно влиять на продуктивность пастбищ,
Полученные данные подтверждают, что система землепользования, объединяющая сообщества древесных растений с травами, способствует разнообразию и стабильности ландшафтов, рациональному использованию земель 3, 4 . Известно, что накопление СО2 и других газов, присутствующих в атмосфере в небольших количествах,

Студент спорофитное развитие микроспор происходило только в пыльниках свежеубраных колосьев,
Саратовская обл., 2006 2008 годы донорные растения первичных гекса и октаплоидных тритикале, полученных с использованием сортов озимой ржи саратовской селекции, и допущенного к использованию в Саратовской области сорта Студент. Свежеубранные колосья, пыльники которых содержали вакуолизированные микроспоры,

США 1353, 1078, 872, 603, 310, 281, 271, 234, 194,
ЂЂЂ круглолистности, Волжанин ЂЂЂ кустистости и нитевидности ростков, Рубин ЂЂЂ кустистости и нитевидности ростков и в Ленинградской обл. ЂЂЂ сорта Чародей с признаками кудряша . PДНК для полимеразной цепной реакции ПЦР выделяли с помощью набора реактивов для очистки геномной ДНК в соответствии с регламентом

Государственный реестр селекционных достижений, допущенных к использованию в средней полосе
Рагулина Родничок Уэлси тетраплоидный m Бессемянка мичуринская 210 4,7 4,6 До конца августа Л.И. Дутова, Е.Н. Седов, Т.В. Рагулина, Е.В. Ульяновская, З.М. Серова, Т.Г. Причко, Л.В.Махно Юбиляр 814 Vf ЂЂЂ свободное опыление 130 4,4 4,2 До конца сентября Е.Н. Седов, З.М. Серова, В.В. Жданов, Г.А. Седышева

Достоверных сведений об образовании в этих условиях труднорастворимых лектинов крайне мало,
П р и м е ч а н и е. Приведены результаты, рассчитанные для уровня значимости Р = 0,01. Доза гербицида — 1 л га. У всех изученных сортов при обработке растений в фазу 2 листьев резко уменьшалось содержание белка, то есть происходил гидролиз белков, ускоряющийся при гербицидном стрессе. Так, у сорта

На 4 й сезон роста 2009 год все сеянцы в семьях Валентиновка x
Осиповская 23 0 0 75,0 16,7 8,3 2041 1044 20 80 x Баяна 22 0 0 28,6 42,8 28,6 2047 79 1 89 x 1439 23 139 31 0 0 22,2 22,2 55,6 2049 Орловская звезда x 1440 25 37 18 0 0 26,7 13,3 60,0 2059 Ася свободное опыление 36 20,0 30,0 50,0 0 0 2060 Нива свободное опыление 54 26,5 0 73,5 0 0 2064 Виксне свободное опыление 30 17,6 52,9 35,3 0 0 2052

Амплификацию проводили в следующем режиме: 3 мин при 94 °С далее 40 циклов:
F . graminearum в процессе селекции на повышенную устойчивость к фузариозной корневой гнили. Для сравнения межсортовых различий в анализ были включены семена сорта Диас 2. При выделении ДНК использовали набор «Diatom DNA Prep 100» ООО «Биоком», Россия . Методика выделения основана на сорбции преимущественно высокомолекулярной фракции нуклеиновых кислот на частицах сорбента,

Кандиль орловский 4 14,3±2,8 6,5 18,3 39,0 Веньяминовское 6 14,0±1,8 6,5 19,2 32,2
Выделено 73 сорта с содержанием пектиновых веществ в плодах более 12,0 табл. 1 . 1. Сорта яблони генофонда Всероссийского НИИ селекции плодовых культур с высоким содержанием пектиновых веществ в плодах в расчете на сухую массу Орловская обл., среднемноголетние данные, цит. по 13 Содержание, Сорт 12,1 13,0

 [1]  [2]  [3]  [4]  [5]  [6]