Сбор клейковины зерна с 1 га посева у сортов и линий яровой мягкой пшеницы при разных сроках посева учебно опытное хозяйство «Миловское»,
Среднее: общее 18,2 25,1 13,5 26 27,4 8,8 51 25,8 по линиям 18,2 25,2 13,6 25 27,4 8,9 51 25,7 П р и м е ч а н и е. НСР 05 для сравнения средних значений урожайности у сортов и линий в пределах одного срока посева — 0,8 ц га, разных сроков — 1,4 ц га. Линии, достоверно отличающиеся по урожайности от сорта

При уменьшении количества облигатной микрофлоры в биотопе желудочно кишечного тракта освобождаемая экологическая ниша заселялась патогенными,
При использовании раствора сафранинамикроорганизмы не окрашивались, а ооцисты простейших приобретали бледно розо вый цвет. После негативного окрашивания нигрозином ооцисты имели вид прозрачных круглых образований диаметром 5 мкм, снаружи выявлялся отчетливый черный ободок, однако эти препараты быстро выцветали,

При увеличении продолжительности воздействия дифференцированными сигналами до 3 мин доминирующим животным потребовалось меньшее число применений и больше подходов к кормушке,
Достоверность различий между групповыми средними оценивали, используя t критерий Стьюдента. Результаты. Вследствие интрасексуального полового отбора поведение бычков в период формирования иерархии в стаде характеризовалось половым возбуждением, многочисленными вспрыгиваниями животных друг на друга,

NAD during the period when other subunits are closed by
The second and third variants: the content of hydrazones of pyruvate in samples was determined after purification by thin layer chromatography. The synthesis of 2,4 dinitrophenyl hydrazones was followed by extraction of them with toluene and the reverse extraction into an aqueous solution of soda 7 .

Коэффициент корреляции между максимальными значениями интенсивности доения и
Индивидуальные показатели скорости доения и кровоснабжения половины вымени у коров черно пестрой породы M ± m , виварий Всероссийского НИИ физиологии, биохимии и питания сельскохозяйственных животныхг. Боровск, Калужская обл. Номер коровы Интенсивность доения, кг мин Разовый удой половины вымени, кг

Отношение соответственно числа полученных трансгенных цыплят и эмбрионов к числу развившихся эмбрионов,
Препараты просматривали под микроскопом «Opton», Германия и документировали с использованием компьютерной программы Image Scope ООО «Системы для микроскопии и анализа», Россия . Результаты. При оценке тропности ретровирусных генных конструкций в экспериментах с клеточной культурой in vitro и одним из используемых в работе векторов — pLN

Интенсивность реализации рефлекса молокоотдачи во многом определяется индивидуальными особенностями коров,
Общая продолжительность доения составила в среднем 276,4 с. Резкое повышение ОСК см. рис. 1, точка D наблюдали через 68,5 с от начала доения. ОСК достигала наибольших значений через 157 с от начала доения или через 88,5 с от начала резкого подъема ОСК . Продолжительность периода повышенных значений

DN between different animal species plotted upon the frequency of 25 loci identified in amplification spectra through
PIC was determined using a formula for diallel loci: PIC = 2f 1 f , where f frequency of one of the two alleles. PIC mean was found over the entire spectrum of amplification products PICm . The estimates of amplicons’ polymorphism were used to calculate genetic distances DN, M. Nei, 1978 between groups,

Seip D., Weckworth B.V., Musiani M. Survival in the
Respubliki Sakha Yakutiya na 2002 2006 gody . Utv. rasporyazheniem Prezidenta Respubliki Sakha Yakutiya ot 23 dekabrya 2002 goda № 328 RP The President Program for social and economic development of the Sakha Republic in 2002 2006. Approved by the decree of President of Sakha Republic № 328 RP of December 23,

Silencing the flavonoid pathway in Medicago truncatula inhibits root nodule formation and prevents auxin transport regulation by rhizobia.
Op den Camp H.J.M., Bouwmeester H., Kohlen W., Bisseling T., Geurts R. Rhizobium lipo chitooligosaccharide signaling triggers accumulation of cytokinins in Medicago truncatula roots. Molecular Plant , 2015, 8 8 : 1213 1226 Kisiala A., Laffont C., Emery J.R.N., Frugier F. Bioactive cytokinins are selectively secreted by

ЂЂЂ побеги соответственно 1 го, 2 го и 3 го порядка.
Краевые 9,1 9,3 11,7 14,3 Средние 8,0 6,7 9,7 11,7 Внутренние 5,0 5,0 8,3 10,0 В среднем по группе 8,1 7,0 9,9 12,0 В среднем для побегов порядка 9,3 8,6 10,8 13,9 Средние Краевые 11,5 10,8 13,2 16,3 Средние Средние 9,3 8,3 11,2 12,9 Средние Внутренние 6,9 6,7 9,0 11,4 П р и м е ч а н и е. 1, 2, 3 и 4

Брянской области и прилегающих территорий поверхностному загрязнению радионуклидами в результате аварии на
Почвы: серые и светло серые лесные легкосуглинистые, темно серые лесные, дерново подзолистые легкосуглинистые на покровных и моренных суглинках, на лессовидных суглинках, дерново подзолистые супесчаные и песчаные. Зернобобовые, фруктовые 0,6 Выгоничский То же Зернобобовые 0,5 Гордеевский Ландшафт: морено зандровые равнины с волнистым и плоским характером поверхности.

Ae. cylindrica regardless of crossing direction ,
Belarusskaya 12 × Lutescens 6747 regardless of crossing direction, the weight of 1000 grains Ae. comosa Belarusskaya 12 × Altayskaya 92 in direct crosses, Lutescens 6747 Í Ae. comosa Omskaya 19 in backcrosses the productive tillering in direct crosses Ae. cylindrica Omskaya 19 ×

Масса яйца — один из основных показателей яичной продуктивности.
Активированный промотор заставляет экспрессироваться ген бычьего гормона роста. У трансгенных по этой конструкции перепелов происходит синтез указанного гормона, что продемонстрировано нами ранее 5, 11 . Рис. 1 . Физическая карта плазмиды pMTbGH 2 x att указаны сайты рестрикции эндонуклеазами , использованной в качестве генной конструкции при получении генетически модифицированных перепелов описание см.

грузовые авиаперевозки
РАН «Фундаментальные основы управления биологическими ресурсами» в 2003 2005 годах мы отрабатывали методы интенсивного семенного размножения ирисов в условиях открытого грунта с использованием девяти синтетических регуляторов роста — гетероауксина, крезацина, фитона, а также новых ФАВ, синтезированных в

МС у скота созданных типов позволяет проследить интродукцию пород,
МС, а также наличия и частоты встречаемости аллелей микро сателлитов, общих для каждой из групп по D. Paetkau с соавт. 8 , показало рис. 1 , что смоленский тип бурой швицкой породы консолидирован и формирует массив, относительно обособленный от исходных пород, участвовавших в выведении. Вероятность отнесения индивидуума к собственной популяции на основании анализа аллельных профилей

Live weight, g абвг abcd Weight of eggs laid by transgenic quails was greater than that in control
In transgenic quails carrying this construct, the synthesis of this hormone was demonstrated previously 5, 11 . Fig . 1. Physical map of the plasmid pMTbGH 2xatt shown sites of restriction with endonucleases used as a gene construct to obtain genetically modified quail description see “Results” . Transgenic quails exceeded the control bird by live weight over the 15 studied generations

Отметим, что в принципе оба метода дают положительные результаты,
Как было показано, каллус формировался с высокой частотой при концентрации 2,4 Д в среде 3 мг л, регенерационная способность была наибольшей при концентрации 3 мг л в среде для получения и 1 мг л ЂЂЂ в среде для пассирования каллуса. Частота регенерации растений из каллусных тканей, культивируемых на средах с высоким содержанием гормонов,

Whanger 8 , абсорбция селена происходит в тонком кишечнике несколько большую скорость транспорта обеспечивает 12 перстная кишка ,
II групп см. в разделе «Методика». , и Соответственно p 0,05,  p 0,01 и p 0,001. Содержание селена в мышечной ткани и внутренних органах животных опытных групп было достоверно выше, чем в контроле. Распределение селена по органам и тканям зависело от формы используемого соединения. Так, у свиней I и

Atoll A-460E A-550 MAX
Аксайский усатый 5 85,1 61,6 38,4 0,62 18,2 81,8 Мультик 85,8 57,4 42,6 0,74 18,5 81,5 Алла 81,3 53,9 46,1 0,86 23,5 76,5 УС П 98 388 84,3 58,0 42,0 0,72 16,3 83,7 С редуцированными прилистниками генотип af af st st Филби 86,0 57,3 42,8 0,75 23,5 76,5 Среднее по безлисточковым сортам 84,1 57,1 42,9 0,76 20,5 79,5

RNA inhibition of starch branching enzyme activity on properties of potato starch.
Available http: www.foodmarket.spb.ru archive.php year=2016&number=155&article =2236. No date in Russ. . Jobling S. Improving starch for food and industrial applications. Curr . Opin . Plant Biol ., 2004, 7: 210 218 Comparot Moss S., Denyer K. The evolution of the starch biosynthetic pathway in cereals and other grasses.

Б, среднее по породам прекос и романовская, n = 150 ,
Al 0,055±0,004 1,6 0,111±0,005 1,9 0,176±0,009 8,5 0,415±0,013 6,7 Gl 1 – – – – 0,112±0,008 5,4 – – Gl 2 – – – – 0,095±0,006 4,6 – – Pp 0,047±0,002 1,4 0,080±0,004 1,4 0,077±0,005 3,7 0,102±0,009 2,6 Ig 1 0,097±0,003 – 2,9 – – – – – – – – – 0,237±0,015 3,8 Ig 2 0,502±0,020 8,1 прочие 0,026±0,002 0,8 – – – – 0,109±0,005 1,7

England , 20 — Milton Canada , 21 — Eritrospermum 609
Grain formation and ripening are the processes related to creation of an offspring generation out of the photosynthesis in leaves and other green plant organs. Premature defoliation, abscission by leaf eating insects, fungal diseases or experimental artificial deletion contribute to a stress and change in a quantitative relationship between producing plant organs and ones consuming assimilates,

По количеству незаменимых аминокислот значительных различий с контролем не отмечали.
Птицу выращивали без разделения по полу с соблюдением технологических условий содержания, кормили вволю сухими полнорационными кормами по нормам питательной ценности, рекомендованным для указанного кросса 8 . В корм птицы из опытной группы добавляли исследуемый нанокомплекс в дозе 30 г т. Кормовые антибиотики не использовали.

насос трехплунжерный типа нк
To prepare the smears,  a drop of peripheral blood was mixed on a slide with a drop of saline, evenly distributed on surface, dried, fixed with methanol for 30 min and stained with Giemsa dye “Merk”, Germany . The number of erythrocytes with micronuclei was determined in 3000 cells and calculated to 1000 cells ‰ .

Глутаминовая кислота 187,21±6,56 201,80±7,06 Глутамин 853,52±29,88 946,40±33,14 &alpha
Полученные данные обрабатывали статистически 8 .  Результаты . Гематологические и иммунологические показатели у быков и коров в основном соответствовали нормативам, свойственным породе, хотя содержание &alpha и &gamma глобулинов было ниже, а &beta глобулинов — выше нормы. Быки производители, получавшие рацион,

ПДК для плодов и ягод 14 0,400 0,500 10,000 5,000 50,000
Поступление микроэлементов в растения может быть пассивным по градиенту концентрации или активным против градиента концентрации с затратой энергии , что предполагает существование двух главных факторов формирования элементного химического состава растений — генетического и экологического. Доля каждого варьирует в зависимости от изменений условий среды.

Все испытанные мембраны, обладая 100 селективностью по белку,
Эффективность мембран оценивали по кратности концентрирования препарата измеряя объем фильтрата в мерном сосуде на выходе из ультрафильтрационной установки , величине и стабильности биологической активности вируса в концентрате ВСМ, степени очистки материала по белку, скорости фильтрации, селективности и технологичности.

Е2 в зависимости от возраста научно производственный опыт,
Во всех хозяйствах на протяжении периода наблюдений качество потребляемых животными кормов в основном соответствовало II IV классу, то есть оказалось ниже требуемого. Практически повсеместно тип кормления был сено силосно концентратным, в рационах регистрировали недостаток сырого протеина и каротина,

канат стальной оцинкованный купить
Кровь, мкг мл 0,16± 0,14 0,64± 0,13 0,85± 0,11 1,07± 0,37 1,56± 0,38 1,36± 0,27 0,89± 0,13 1,08± 0,21 0,96± 0,18 Плацента, мкг г 0,98± 0,12 0,63± 0,11 0,58± 0,14 0,28± 0,09 0,52± 0,15 0,64± 0,12 0,55± 0,18 0,41± 0,04 0,35± 0,11 Предплоды плоды Мышечная ткань, мкг г 0,29± 0,10 0,84± 9,21 0,76± 0,07 0,05± 0,45 1,39± 0,37 1,27± 0,25 1,05± 0,25 1,07± 0,12

Как известно, в условиях постоянно варьирующих факторов внешней среды и конкурентных взаимоотношений всегда наблюдается та или иная степень изменчивости внутри сорта как результат морфофизиологических приспособительных реакций 9 11 ,
В начале вегетации в фазу всходов посев по параметрам площади листовой поверхности и сухой массе был однороден и характеризовался относительно невысокими средними значениями показателей табл. 1 . 1. Средние значения Х ± х , стандартное отклонение d и коэффициент вариации Cv морфологических показателей у растений яровой пшеницы сорта

По числу колосков в мутовке у овса посевного размах варьирования был выше,
США 2,4±0,1 2,7±0,1 4,2±0,1 12,9 16,4 9,2 3,3±0,2 2,9±0,2 4,6±0,2 5,1±0,3 15,6 17,7 16,6 17,9 веточек общее 5419 4877 14762 11714 Турция Турция США США 15,1±8,0 29,0±0,9 16,9 10,5 20,0±2,2 14,8±1,5 30,3±1,6 33,6±1,6 31,7 32,9 16,2 14,0 колосков в мутовке 4763 4742 12216 10509 Алжир Алжир Индия Индия 21,9±1,6 79,5±4,3 22,8 17,0 37,8±4,7 21,3±2,1 49,2±11,8 84,1±5,5 39,7 30,1 72,0 20,6 зерен в метелке 11404 4742 13906 7936

Аминокислота, : лизин 1,550± 0,132 1,730± 0,077 2,010± 0,089 1,510± 0,081 1,730± 0,078 1,510± 0,111 метионин 0,240± 0,035 0,350± 0,023 0,430± 0,027 0,250± 0,029 0,340± 0,024 0,270± 0,032 цистеин 0,970± 0,035 0,880± 0,025 0,870± 0,011 0,920± 0,017 0,890± 0,036 0,880± 0,035 гистидин 0,560± 0,054 0,590± 0,027 0,710± 0,034 0,540± 0,030 0,580± 0,035 0,530± 0,043 аргинин 0,120± 0,044 0,270± 0,046 0,480± 0,060 0,090± 0,027 0,250± 0,065 0,270± 0,048 треонин 0,150± 0,036 0,300± 0,030 0,410± 0,038 0,140± 0,036 0,290± 0,032 0,220± 0,032 серин 0,080± 0,039 0,260± 0,035 0,360± 0,053 0,080± 0,021 0,220± 0,047 0,180± 0,033 пролин 0,680± 0,119 0,310± 0,101 0,420± 0,155 0,690± 0,111 0,380± 0,083 0,600± 0,121 глицин 0,530± 0,035 0,180± 0,030 0,140± 0,043 0,500± 0,042 0,200± 0,058 0,370± 0,037 валин 0,800± 0,131 2,220± 0,025 2,200± 0,188 0,910± 0,111 1,970± 0,290 1,550± 0,125 изолейцин 0,650± 0,046 0,120± 0,046 0,200± 0,068 0,550± 0,055 0,200± 0,090 0,340± 0,048 лейцин 1,020± 0,097 0,970± 0,051 1,180± 0,085 0,950± 0,077 0,960± 0,068 0,090± 0,090 тирозин 0,030± 0,009 0,070± 0,007 0,070± 0,016 0,030± 0,004 0,060± 0,015 0,070± 0,011 фенил аланин 0,150± 0,044 0,190± 0,031 0,320± 0,037 0,100± 0,025 0,200± 0,040 0,200± 0,033
Корневая система растений молодых, 2004 год среднего возраста, 2004 год среднего возраста, 2005 год Аминокислота, : лизин 0,820±0,044 0,340±0,067 0,350±0,043 0,760±0,177 метионин 0,400±0,012 0,060±0,009 0,040±0,011 0,080±0,047 цистеин 0,290±0,015 0,820±0,020 0,490±0,016 0,790±0,089 гистидин 0,300±0,020 0,100±0,025 0,090±0,017 0,240±0,073 аргинин 1,120±0,030 0,640±0,039 0,630±0,020 0,420±0,065 треонин 0,650±0,018 0,240±0,023 0,230±0,013 0,120±0,023 серин 0,790±0,021 0,370±0,023 0,380±0,016 0,140±0,021 пролин 2,280±0,049 1,740±0,059 1,560±0,087 0,890±0,122 глицин 1,180±0,008 0,710±0,023 0,670±0,018 0,520±0,034 валин 1,130±0,035 0,970±0,070 0,990±0,094 1,620±0,170 изолейцин 0,120±0,014 0,230±0,042 0,230±0,044 0,190±0,028 лейцин 0,550±0,032 0,230±0,050 0,190±0,034 0,370±0,139 тирозин 0,400±0,007 0,110±0,011 0,100±0,009 0,140±0,021 фенилаланин 0,850±0,020 0,430±0,031 0,410±0,018 0,280±0,029

VI 70,00±4,15 75,46±1,53 8,39±0,19 VII 71,25±5,61 76,40±1,90 8,45±0,33 20 е   с у т   п о с л е   о п о р о с а
Р 0,05 у лактирующих особей — на 7,70 14,70 Р 0,05 и 17,90 Р 0,05 см. рис. . Содержание иммуноглобулинов в сыворотке крови свиноматок в разные сроки супоросности и лактации в зависимости от количества аскорбиновой кислоты А и свекловичной патоки Б в рационах: а, б, в, г, д, е, ж — соответственно I контроль ,

индивидуальный инструктор
Комбикорма содержали 10 подсолнечного шрота до 21 х сут выращивания и 20 — с 22 х сут до убоя 37 е сут . Учитывали сохранность поголовья, живую массу бройлеров в возрасте 1, 21 и 37 сут, потребление корма за период выращивания в расчете на 1 гол., затраты корма на 1 кг прироста живой массы на окончание опыта ,

Московского зоопарка Волоколамский р н, Московская обл.
Площадь гнездовой камеры в берлоге составляла около 2 м 2 . Сверху берлоги делали земляную насыпь высотой 1,5 м. В убежище устанавливали видеокамеру и электротермометр, с помощью которого измеряли температуру воздуха в норе и снаружи. Видеоинформация круглосуточно регистрировалась компьютером, расположенным в помещении,

А в сыворотке крови телят, которые получали молозиво в 1 е сут жизни,
II молозиво С в о б о д н о р а д и к а л ь н о е о к и с л е н и е л и п и д о в Через 1 сут ДК, OП 232 мг липидов 0,220±0,0105 0,244±0,0210 МДА, мкмоль л 1,34±0,187 1,96±0,141 Через 2 сут ДК, ОП 232 мг липидов 0,210±0,0124 0,254±0,0320 МДА, мкмоль л 0,99±0,050 1,75±0,025 Через 3 сут ДК, ОП 232 мг липидов 0,212±0,0112 0,240±0,0143

Среднее 7 9 4,30±0,33 39,00±1,52 56,70±1,76 10 32 3,00±0,44 39,00±1,64 58,00±0,73 11 32 4,00±0,46 39,00±0,92 57,00±0,89 12 32 3,00±0,66 42,00±1,23 55,00±1,32
Альфа ритм частота 8 12 кол с, амплитуда 20 60 мкВ см. рис., в наблюдали у животных в спокойном бодрствующем состоянии, реже в состоянии активного бодрствования. Для амплитуды альфа ритма характерна модуляция, запись имеет вид веретена, типичного только для альфа ритма: сначала отмечается волна с низкой амплитудой,

В среднем за 3 года при использовании микробных препаратов происходило увеличение числа активных клубеньков на корнях гороха в 1,2 1,6 раза с одновременным ростом его урожайности на 19 25 ,
Урожайность гороха посевного сорта Татьяна при использовании микробиологических препаратов и минеральных удобрений Орловская обл., 2003 2005 годы Вариант Урожайность, т га Прибавка к контролю, Контроль 2,15 Бисолбисан 2,67 24,2 Бисолбимикс 2,89 34,4 N 22,5 P 30 K 45 2,66 23,7 N 22,5 P 30 K 45 бисолбисан 2,80 30,2

очистные сооружения для автомоек
Catctctggctgggttcttc 3&prime rv 5&prime Aattgcttcggaaccacaag 3&prime 59 115 XM 420348 fw 5&prime gagctgccaaaaactgcttc 3&prime rv 5&prime agatcagcctcttgcaccat 3&prime 59 142 NM 001031126 fw 5&prime gcagcagaaagagcagagg 3&prime rv 5&prime tcgttagcctcagtccacct 3&prime 59 103 XM 420350 fw 5&prime Aacgacctggagaagcagaa 3&prime rv 5&prime

Koltai eds. . Springer, NY, 2010 Hanlon M.T., Coenen
AM efficiency by weight for aboveground parts, and, therefore, a shift in IAA concentration significantly intensified development of the aboveground parts at the shooting and flowering. Keywords: auxin, indolilacetic acid, arbuscular mycorrhiza, symbiotic efficiency, Rhizophagus irregularis , Medicago lupulina.

ЛЭК 3 5 2,95±0,05 ТБ 3 5 2,79±0,03 Диплоидные: Т3Э 4 5 2,19±0,16
Исходный титр вируса lg ТЦД 50 мл при заражении составлял 1,5 3,0. Вирус культивировали при температуре 37 °С в стационарных условиях. Инфекционную активность РС вируса в культуре клеток определяли по цитопатическому действию ЦПД титрованием микро и пробирочным методом, инфекционный титр рассчитывали по

Оценка действия температурного фактора на урожай зерна показала,
В о з д у ш н о с у х а я м а с с а, г 0 10 1,02± 0,01 1,05± 0,02 1,02± 0,01 — — 0 20 0,53± 0,01 0,53± 0,01 0,53± 0,01 — — 0 25 0,44± 0,01 0,55± 0,01 0,61± 0,01 — — 220 10 1,03± 0,02 0,87± 0,01 0,85± 0,01 — — 470 10 1,05± 0,01 0,87± 0,01 0,98± 0,01 — — 220 20 0,75± 0,02 0,40± 0,01 0,40± 0,01 — — 470 20 0,76± 0,01 0,44± 0,01 0,48± 0,01 — — 220 25 0,33± 0,01 0,40± 0,01 0,53± 0,01 — — 470 25 0,32± 0,01 0,48± 0,01 0,57± 0,01 — —

Cloning , 2000, 2: 79 90 Loi P., Modlinski J.A., Ptak
Oxford University Press, Oxford, UK, 2006. Martinsen G.D., Whitham T.G., Turek R.J., Keim P. Hybrid populations selectively filter gene introgression between species. Evolution , 2001, 55 7 : 1325 1335 Schwenk K., Brede N., Streit B. Introduction. Extent, processes and evolutionary impact of interspecific hybridization in animals.

Измайловского парка превышало минимальное 4 мг кг более чем в 60,0 раза.
Для абсорбции ртути внутренняя поверхность графитовой печи атомизатора спектрометра предварительно покрывается слоем высокодисперсного палладия. Результаты . Вода из трех водоемов, на которых были отловлены утки, существенно различалась по содержанию поллютантов табл. 1 . Наибольшим содержанием Pb характеризовались водоемы

Available https: www.researchgate.net publication 278870707
Impacts of oxidative stress and antioxidants on semen functions. Veterinary Medicine International , 2011, 2011: Article ID 686137 Uysal O., Bucak M.N. Effects of oxidized glutathione, bovine serum albumin, cysteine and lycopene on the quality of frozen thawed ram semen. Acta Vet. Brno , 2007, 76 3 :

Так, содержание главных казеиновых фракций &alpha s 1 и &beta в молозиве составило соответственно 0,891 и 0,777 г 100 мл,
Содержание в молозиве после отела в молоке через 24 ч на 3 4 е сут на 5 6 е сут г 100 мл г 100 мл г 100 мл г 100 мл Об щий 14,421±0,041 100 5,193±0,096 100 3,387±0,047 100 3,328±0,053 100 Казе ины: 2,755±0,046 19,1 2,671±0,051 51,4 2,664±0,048 78,7 2,613±0,044 78,5 F 0,044±0,004 0,3 0,043±0,004 0,8 0,046±0,004 1,4 0,048±0,008 1,4 &alpha s´ 0,135±0,009 0,9 0,124±0,010 2,4 0,128±0,010 3,8 0,117±0,015 3,5 &alpha s 0 0,201±0,009 1,4 0,183±0,011 3,5 0,203±0,013 6,0 0,189±0,006 5,7 &alpha s 1 0,891±0,025 6,2 0,898±0,029 17,3 0,883±0,022 26,1 0,844±0,022 25,4 &alpha s 2 0,280±0,019 1,9 0,290±0,020 5,6 0,274±0,015 8,1 0,230±0,009 6,9 &beta 0,777±0,019 5,4 0,733±0,025 14,1 0,714±0,024 21,1 0,796±0,018 23,9 &kappa 0,230±0,011 1,6 0,230±0,011 4,4 0,228±0,013 6,7 0,232±0,010 7,0 &gamma 0,111±0,009 0,8 0,091±0,006 1,8 0,099±0,008 2,9 0,076±0,004 2,3 s 0,087±0,008 0,6 0,079±0,005 1,5 0,089±0,006 2,6 0,081±0,007 2,4

Хуштада 257±16 127±21 8,6 8,6 Среднее 304±52 202±49 9,9
Кроме того, провели сравнительную оценку содержания селена в яйцах у несушек на птицефабриках ПФ , использующих селенит натрия, — ООО «Краснодарская ПФ», ПФ «Новороссийская», ООО «Магнитогорский птицеводческий комплекс», ОАО «Кондопожская ПФ», ЗАО ПФ «Роскар» Ленинградская обл. , ОНО «Загорское ЭПХ

Ростовской области степень загрязнения зерна кукурузы фузариотоксинами оставалась столь же значительной 34 образца из 36 .
Ю ж н ы й ф е д е р а л ь н ы й о к р у г 2002 год 51 47 47 9 — — 37 — — — 10 — — — — — — 2003 год 38 34 34 6 2 4 27 — — — 2 — 1 — 3 — 1 2004 2005 годы 36 34 31 19 7 — 12 3 — — 12 — 3 — — 4 — З е р н о р и с а К р а с н о д а р с к и й к р а й 2002 год 15 12 2 12 — — — 10 — — 2 — — — — — — 2003 год 7 6 4 6 1 4 — 1 — — 1 — — 1 2 — 1

L — расстояние между опорами, на которых расположена исследуемая кость
У собак под общей анестезией провели остеотомию правой большеберцовой кости под углом 12° к длинной оси косой перелом и иммобилизировали отломки посредством двух циркулярно наложенных на диафиз кости стягивающих полос авторской конструкции 7 левая большеберцовая кость служила контролем . После операции животным был назначен курс общей послеоперационной терапии,

 [1]  [2]  [3]  [4]  [5]  [6]