Отметим, что в принципе оба метода дают положительные результаты,
Как было показано, каллус формировался с высокой частотой при концентрации 2,4 Д в среде 3 мг л, регенерационная способность была наибольшей при концентрации 3 мг л в среде для получения и 1 мг л ЂЂЂ в среде для пассирования каллуса. Частота регенерации растений из каллусных тканей, культивируемых на средах с высоким содержанием гормонов,

Whanger 8 , абсорбция селена происходит в тонком кишечнике несколько большую скорость транспорта обеспечивает 12 перстная кишка ,
II групп см. в разделе «Методика». , и Соответственно p 0,05,  p 0,01 и p 0,001. Содержание селена в мышечной ткани и внутренних органах животных опытных групп было достоверно выше, чем в контроле. Распределение селена по органам и тканям зависело от формы используемого соединения. Так, у свиней I и

Испарение с поверхности усиков у сортов Орлус и Норд составляло в расчете на сырую массу соответственно 551 и 328,
Аксайский усатый 5 85,1 61,6 38,4 0,62 18,2 81,8 Мультик 85,8 57,4 42,6 0,74 18,5 81,5 Алла 81,3 53,9 46,1 0,86 23,5 76,5 УС П 98 388 84,3 58,0 42,0 0,72 16,3 83,7 С редуцированными прилистниками генотип af af st st Филби 86,0 57,3 42,8 0,75 23,5 76,5 Среднее по безлисточковым сортам 84,1 57,1 42,9 0,76 20,5 79,5

Б, среднее по породам прекос и романовская, n = 150 ,
Al 0,055±0,004 1,6 0,111±0,005 1,9 0,176±0,009 8,5 0,415±0,013 6,7 Gl 1 – – – – 0,112±0,008 5,4 – – Gl 2 – – – – 0,095±0,006 4,6 – – Pp 0,047±0,002 1,4 0,080±0,004 1,4 0,077±0,005 3,7 0,102±0,009 2,6 Ig 1 0,097±0,003 – 2,9 – – – – – – – – – 0,237±0,015 3,8 Ig 2 0,502±0,020 8,1 прочие 0,026±0,002 0,8 – – – – 0,109±0,005 1,7

Амилаза, ед л: до введения 3339,30a192,43 4699,00a506,30 4617,60a871,01 3779,30a514,20 3 и сут 3528,60a288,65 4595,00a571,85 4880,00a427,73 2623,60a130,67 10 е сут 3792,60a276,80 4102,30a324,37 4354,00a932,30 3610,00a185,70
Гемоглобин, г л: до введения 121,40a3,85 109,69a4,51 116,27a5,42 117,84a4,78 3 и сут 123,20a3,85 114,90a4,37 117,58a4,50 120,63a4,28 10 е сут 124,28a4,95 125,80a4,22 129,96a4,20 116,84a2,42 Число эритроцитов, m1012 л: до введения 5,29a0,14 5,32a0,34 5,56a0,41 5,08a0,14 3 и сут 5,95a0,59 5,49a0,32 6,30a0,21 5,53a0,30 10 е сут 6,47a0,39 6,10a0,34 6,29a0,32 5,33a0,22

England , 20 — Milton Canada , 21 — Eritrospermum 609
Grain formation and ripening are the processes related to creation of an offspring generation out of the photosynthesis in leaves and other green plant organs. Premature defoliation, abscission by leaf eating insects, fungal diseases or experimental artificial deletion contribute to a stress and change in a quantitative relationship between producing plant organs and ones consuming assimilates,

The peak of pyruvate content shifted relative to control from 3,5 h to 7 h of incubation.
Concentration of hexoses, umol cm 3 The content of pyruvic acid was established upon its ability to form 2,4 dinitrophenylhydrazones, which were purified by reverse extraction from toluene solution into an aqueous solution of soda Na 2 CO 3 and transferred to the aci form by adding sodium hydroxide solution 8 .

По количеству незаменимых аминокислот значительных различий с контролем не отмечали.
Птицу выращивали без разделения по полу с соблюдением технологических условий содержания, кормили вволю сухими полнорационными кормами по нормам питательной ценности, рекомендованным для указанного кросса 8 . В корм птицы из опытной группы добавляли исследуемый нанокомплекс в дозе 30 г т. Кормовые антибиотики не использовали.

It can be expected that such differences are the result of natural selection for high resistance to unfavorable environmental factors.
To prepare the smears,  a drop of peripheral blood was mixed on a slide with a drop of saline, evenly distributed on surface, dried, fixed with methanol for 30 min and stained with Giemsa dye “Merk”, Germany . The number of erythrocytes with micronuclei was determined in 3000 cells and calculated to 1000 cells ‰ .

шапка капюшон оптом
Содержание гемоглобина у молодняка норок также находилось в пределах физиологической нормы от 150,2±11,3 до 156,3±24,1 г л , к концу опыта наблюдалась тенденция к увеличению этого показателя. К окончанию эксперимента во всех опытных группах возрастало число тромбоцитов наиболее значительно — у особей из

Глутаминовая кислота 187,21±6,56 201,80±7,06 Глутамин 853,52±29,88 946,40±33,14 &alpha
Полученные данные обрабатывали статистически 8 .  Результаты . Гематологические и иммунологические показатели у быков и коров в основном соответствовали нормативам, свойственным породе, хотя содержание &alpha и &gamma глобулинов было ниже, а &beta глобулинов — выше нормы. Быки производители, получавшие рацион,

Все испытанные мембраны, обладая 100 селективностью по белку,
Эффективность мембран оценивали по кратности концентрирования препарата измеряя объем фильтрата в мерном сосуде на выходе из ультрафильтрационной установки , величине и стабильности биологической активности вируса в концентрате ВСМ, степени очистки материала по белку, скорости фильтрации, селективности и технологичности.

Е2 в зависимости от возраста научно производственный опыт,
Во всех хозяйствах на протяжении периода наблюдений качество потребляемых животными кормов в основном соответствовало II IV классу, то есть оказалось ниже требуемого. Практически повсеместно тип кормления был сено силосно концентратным, в рационах регистрировали недостаток сырого протеина и каротина,

По нашему мнению, это связано с проявлением защитных свойств плаценты на ранней стадии внутриутробного развития.
Кровь, мкг мл 0,16± 0,14 0,64± 0,13 0,85± 0,11 1,07± 0,37 1,56± 0,38 1,36± 0,27 0,89± 0,13 1,08± 0,21 0,96± 0,18 Плацента, мкг г 0,98± 0,12 0,63± 0,11 0,58± 0,14 0,28± 0,09 0,52± 0,15 0,64± 0,12 0,55± 0,18 0,41± 0,04 0,35± 0,11 Предплоды плоды Мышечная ткань, мкг г 0,29± 0,10 0,84± 9,21 0,76± 0,07 0,05± 0,45 1,39± 0,37 1,27± 0,25 1,05± 0,25 1,07± 0,12

Как известно, в условиях постоянно варьирующих факторов внешней среды и конкурентных взаимоотношений всегда наблюдается та или иная степень изменчивости внутри сорта как результат морфофизиологических приспособительных реакций 9 11 ,
В начале вегетации в фазу всходов посев по параметрам площади листовой поверхности и сухой массе был однороден и характеризовался относительно невысокими средними значениями показателей табл. 1 . 1. Средние значения Х ± х , стандартное отклонение d и коэффициент вариации Cv морфологических показателей у растений яровой пшеницы сорта

По числу колосков в мутовке у овса посевного размах варьирования был выше,
США 2,4±0,1 2,7±0,1 4,2±0,1 12,9 16,4 9,2 3,3±0,2 2,9±0,2 4,6±0,2 5,1±0,3 15,6 17,7 16,6 17,9 веточек общее 5419 4877 14762 11714 Турция Турция США США 15,1±8,0 29,0±0,9 16,9 10,5 20,0±2,2 14,8±1,5 30,3±1,6 33,6±1,6 31,7 32,9 16,2 14,0 колосков в мутовке 4763 4742 12216 10509 Алжир Алжир Индия Индия 21,9±1,6 79,5±4,3 22,8 17,0 37,8±4,7 21,3±2,1 49,2±11,8 84,1±5,5 39,7 30,1 72,0 20,6 зерен в метелке 11404 4742 13906 7936

Аминокислота, : лизин 1,550± 0,132 1,730± 0,077 2,010± 0,089 1,510± 0,081 1,730± 0,078 1,510± 0,111 метионин 0,240± 0,035 0,350± 0,023 0,430± 0,027 0,250± 0,029 0,340± 0,024 0,270± 0,032 цистеин 0,970± 0,035 0,880± 0,025 0,870± 0,011 0,920± 0,017 0,890± 0,036 0,880± 0,035 гистидин 0,560± 0,054 0,590± 0,027 0,710± 0,034 0,540± 0,030 0,580± 0,035 0,530± 0,043 аргинин 0,120± 0,044 0,270± 0,046 0,480± 0,060 0,090± 0,027 0,250± 0,065 0,270± 0,048 треонин 0,150± 0,036 0,300± 0,030 0,410± 0,038 0,140± 0,036 0,290± 0,032 0,220± 0,032 серин 0,080± 0,039 0,260± 0,035 0,360± 0,053 0,080± 0,021 0,220± 0,047 0,180± 0,033 пролин 0,680± 0,119 0,310± 0,101 0,420± 0,155 0,690± 0,111 0,380± 0,083 0,600± 0,121 глицин 0,530± 0,035 0,180± 0,030 0,140± 0,043 0,500± 0,042 0,200± 0,058 0,370± 0,037 валин 0,800± 0,131 2,220± 0,025 2,200± 0,188 0,910± 0,111 1,970± 0,290 1,550± 0,125 изолейцин 0,650± 0,046 0,120± 0,046 0,200± 0,068 0,550± 0,055 0,200± 0,090 0,340± 0,048 лейцин 1,020± 0,097 0,970± 0,051 1,180± 0,085 0,950± 0,077 0,960± 0,068 0,090± 0,090 тирозин 0,030± 0,009 0,070± 0,007 0,070± 0,016 0,030± 0,004 0,060± 0,015 0,070± 0,011 фенил аланин 0,150± 0,044 0,190± 0,031 0,320± 0,037 0,100± 0,025 0,200± 0,040 0,200± 0,033
Корневая система растений молодых, 2004 год среднего возраста, 2004 год среднего возраста, 2005 год Аминокислота, : лизин 0,820±0,044 0,340±0,067 0,350±0,043 0,760±0,177 метионин 0,400±0,012 0,060±0,009 0,040±0,011 0,080±0,047 цистеин 0,290±0,015 0,820±0,020 0,490±0,016 0,790±0,089 гистидин 0,300±0,020 0,100±0,025 0,090±0,017 0,240±0,073 аргинин 1,120±0,030 0,640±0,039 0,630±0,020 0,420±0,065 треонин 0,650±0,018 0,240±0,023 0,230±0,013 0,120±0,023 серин 0,790±0,021 0,370±0,023 0,380±0,016 0,140±0,021 пролин 2,280±0,049 1,740±0,059 1,560±0,087 0,890±0,122 глицин 1,180±0,008 0,710±0,023 0,670±0,018 0,520±0,034 валин 1,130±0,035 0,970±0,070 0,990±0,094 1,620±0,170 изолейцин 0,120±0,014 0,230±0,042 0,230±0,044 0,190±0,028 лейцин 0,550±0,032 0,230±0,050 0,190±0,034 0,370±0,139 тирозин 0,400±0,007 0,110±0,011 0,100±0,009 0,140±0,021 фенилаланин 0,850±0,020 0,430±0,031 0,410±0,018 0,280±0,029

VI 70,00±4,15 75,46±1,53 8,39±0,19 VII 71,25±5,61 76,40±1,90 8,45±0,33 20 е   с у т   п о с л е   о п о р о с а
Р 0,05 у лактирующих особей — на 7,70 14,70 Р 0,05 и 17,90 Р 0,05 см. рис. . Содержание иммуноглобулинов в сыворотке крови свиноматок в разные сроки супоросности и лактации в зависимости от количества аскорбиновой кислоты А и свекловичной патоки Б в рационах: а, б, в, г, д, е, ж — соответственно I контроль ,

I группа контроль II группа опыт Сохранность, 94,3 97,1
Комбикорма содержали 10 подсолнечного шрота до 21 х сут выращивания и 20 — с 22 х сут до убоя 37 е сут . Учитывали сохранность поголовья, живую массу бройлеров в возрасте 1, 21 и 37 сут, потребление корма за период выращивания в расчете на 1 гол., затраты корма на 1 кг прироста живой массы на окончание опыта ,

Atoll A-460E A-550 MAX
Са 2 в тромбоцитах и лимфоцитах необлученных овец показало, что его значения составляли в среднем соответственно 2,42±0,25 и 2,33±0,31 мкг мг белка. После внешнего &gamma облучения овец общее содержание Са 2 в тромбоцитах практически не отличалось от исходного независимо от срока исследования и дозы воздействия табл.

Московского зоопарка Волоколамский р н, Московская обл.
Площадь гнездовой камеры в берлоге составляла около 2 м 2 . Сверху берлоги делали земляную насыпь высотой 1,5 м. В убежище устанавливали видеокамеру и электротермометр, с помощью которого измеряли температуру воздуха в норе и снаружи. Видеоинформация круглосуточно регистрировалась компьютером, расположенным в помещении,

Среднее 7 9 4,30±0,33 39,00±1,52 56,70±1,76 10 32 3,00±0,44 39,00±1,64 58,00±0,73 11 32 4,00±0,46 39,00±0,92 57,00±0,89 12 32 3,00±0,66 42,00±1,23 55,00±1,32
Альфа ритм частота 8 12 кол с, амплитуда 20 60 мкВ см. рис., в наблюдали у животных в спокойном бодрствующем состоянии, реже в состоянии активного бодрствования. Для амплитуды альфа ритма характерна модуляция, запись имеет вид веретена, типичного только для альфа ритма: сначала отмечается волна с низкой амплитудой,

В среднем за 3 года при использовании микробных препаратов происходило увеличение числа активных клубеньков на корнях гороха в 1,2 1,6 раза с одновременным ростом его урожайности на 19 25 ,
Урожайность гороха посевного сорта Татьяна при использовании микробиологических препаратов и минеральных удобрений Орловская обл., 2003 2005 годы Вариант Урожайность, т га Прибавка к контролю, Контроль 2,15 Бисолбисан 2,67 24,2 Бисолбимикс 2,89 34,4 N 22,5 P 30 K 45 2,66 23,7 N 22,5 P 30 K 45 бисолбисан 2,80 30,2

Enhanced Avian Reverse Transcriptase PCR Kit «Sigma
Catctctggctgggttcttc 3&prime rv 5&prime Aattgcttcggaaccacaag 3&prime 59 115 XM 420348 fw 5&prime gagctgccaaaaactgcttc 3&prime rv 5&prime agatcagcctcttgcaccat 3&prime 59 142 NM 001031126 fw 5&prime gcagcagaaagagcagagg 3&prime rv 5&prime tcgttagcctcagtccacct 3&prime 59 103 XM 420350 fw 5&prime Aacgacctggagaagcagaa 3&prime rv 5&prime

насос трехплунжерный типа нк
Исходный титр вируса lg ТЦД 50 мл при заражении составлял 1,5 3,0. Вирус культивировали при температуре 37 °С в стационарных условиях. Инфекционную активность РС вируса в культуре клеток определяли по цитопатическому действию ЦПД титрованием микро и пробирочным методом, инфекционный титр рассчитывали по

Оценка действия температурного фактора на урожай зерна показала,
В о з д у ш н о с у х а я м а с с а, г 0 10 1,02± 0,01 1,05± 0,02 1,02± 0,01 — — 0 20 0,53± 0,01 0,53± 0,01 0,53± 0,01 — — 0 25 0,44± 0,01 0,55± 0,01 0,61± 0,01 — — 220 10 1,03± 0,02 0,87± 0,01 0,85± 0,01 — — 470 10 1,05± 0,01 0,87± 0,01 0,98± 0,01 — — 220 20 0,75± 0,02 0,40± 0,01 0,40± 0,01 — — 470 20 0,76± 0,01 0,44± 0,01 0,48± 0,01 — — 220 25 0,33± 0,01 0,40± 0,01 0,53± 0,01 — — 470 25 0,32± 0,01 0,48± 0,01 0,57± 0,01 — —

Cloning , 2000, 2: 79 90 Loi P., Modlinski J.A., Ptak
Oxford University Press, Oxford, UK, 2006. Martinsen G.D., Whitham T.G., Turek R.J., Keim P. Hybrid populations selectively filter gene introgression between species. Evolution , 2001, 55 7 : 1325 1335 Schwenk K., Brede N., Streit B. Introduction. Extent, processes and evolutionary impact of interspecific hybridization in animals.

Измайловского парка превышало минимальное 4 мг кг более чем в 60,0 раза.
Для абсорбции ртути внутренняя поверхность графитовой печи атомизатора спектрометра предварительно покрывается слоем высокодисперсного палладия. Результаты . Вода из трех водоемов, на которых были отловлены утки, существенно различалась по содержанию поллютантов табл. 1 . Наибольшим содержанием Pb характеризовались водоемы

Form ordinate from left to right Plant height, cm
The number of root nodules and nitrogen fixation activity were determined in 10 15 plants from each line in the beginning of flowering using acetylene method 16 on the gas chromatograph devise Tsvet 500 Russia . During maturation, 10 15 plants from the same plots were evaluated for productivity characteristics:

Так, содержание главных казеиновых фракций &alpha s 1 и &beta в молозиве составило соответственно 0,891 и 0,777 г 100 мл,
Содержание в молозиве после отела в молоке через 24 ч на 3 4 е сут на 5 6 е сут г 100 мл г 100 мл г 100 мл г 100 мл Об щий 14,421±0,041 100 5,193±0,096 100 3,387±0,047 100 3,328±0,053 100 Казе ины: 2,755±0,046 19,1 2,671±0,051 51,4 2,664±0,048 78,7 2,613±0,044 78,5 F 0,044±0,004 0,3 0,043±0,004 0,8 0,046±0,004 1,4 0,048±0,008 1,4 &alpha s´ 0,135±0,009 0,9 0,124±0,010 2,4 0,128±0,010 3,8 0,117±0,015 3,5 &alpha s 0 0,201±0,009 1,4 0,183±0,011 3,5 0,203±0,013 6,0 0,189±0,006 5,7 &alpha s 1 0,891±0,025 6,2 0,898±0,029 17,3 0,883±0,022 26,1 0,844±0,022 25,4 &alpha s 2 0,280±0,019 1,9 0,290±0,020 5,6 0,274±0,015 8,1 0,230±0,009 6,9 &beta 0,777±0,019 5,4 0,733±0,025 14,1 0,714±0,024 21,1 0,796±0,018 23,9 &kappa 0,230±0,011 1,6 0,230±0,011 4,4 0,228±0,013 6,7 0,232±0,010 7,0 &gamma 0,111±0,009 0,8 0,091±0,006 1,8 0,099±0,008 2,9 0,076±0,004 2,3 s 0,087±0,008 0,6 0,079±0,005 1,5 0,089±0,006 2,6 0,081±0,007 2,4

Ростовской области степень загрязнения зерна кукурузы фузариотоксинами оставалась столь же значительной 34 образца из 36 .
Ю ж н ы й ф е д е р а л ь н ы й о к р у г 2002 год 51 47 47 9 — — 37 — — — 10 — — — — — — 2003 год 38 34 34 6 2 4 27 — — — 2 — 1 — 3 — 1 2004 2005 годы 36 34 31 19 7 — 12 3 — — 12 — 3 — — 4 — З е р н о р и с а К р а с н о д а р с к и й к р а й 2002 год 15 12 2 12 — — — 10 — — 2 — — — — — — 2003 год 7 6 4 6 1 4 — 1 — — 1 — — 1 2 — 1

L — расстояние между опорами, на которых расположена исследуемая кость
У собак под общей анестезией провели остеотомию правой большеберцовой кости под углом 12° к длинной оси косой перелом и иммобилизировали отломки посредством двух циркулярно наложенных на диафиз кости стягивающих полос авторской конструкции 7 левая большеберцовая кость служила контролем . После операции животным был назначен курс общей послеоперационной терапии,

Dairy Sci ., 2015, 98: 4969 4989 Pryce J.E., Bolormaa
Genetic labeling, conservation of biodiversity and the problems in animals breeding . Sel ’ skokhozyaistvennaya Biologiya Agricultural Biology , 2011, 2: 3 14 in Russ. . Stolpovskii Yu.A. Kontseptsiya i printsipy geneticheskogo monitoringa dlya sokhraneniya in situ porod domestitsirovannykh zhivotnykh

ОСК перед доением по величине разового удоя половины вымени
Объем крови в расчете на 1 л молока, л 1 2 11 я 2,74±0,09 2,85±0,08 682±17 2 2 27 я 2,92±0,07 2,82±0,09 740±20 5 5 13 я 2,70±0,06 3,06±0,17 634±36 6 4 20 я 4,32±0,10 4,20±0,24 751±37 7 4 17 я 2,97±0,16 3,06±0,06 723±40 11 4 18 я 3,45±0,12 4,06±0,12 622±31 12 3 9 я 2,40±0,10 3,09±0,11 549±23 13 2 17 я 2,52±0,14 2,95±0,05 628±20 14 2 27 я 1,93±0,03 1,70±0,12 830±72

индивидуальный инструктор
The changes in immune status of mother cows with embryonic mortality manifested themselves by an increase in the number of blood leukocytes, their neutrophilic and eosinophilic forms, monocytes, by a decrease in phagocytic activity, the number of lymphocytes, immunoglobulins, bactericidal activity and lysozyme activity in blood serum,

Inheritance of physiological nitrogen use efficiency and relationship among its associated charaters in rice.
Kubanskogo gosudarstvennogo agrarnogo universiteta , 2010: 54 58 in Russ. . Goncharova Yu.K. Inheritance of determinants specific for physiological heterosis basis in rice hybrids. Agricultural Biology , 2010, 5: 72 78. Kharitonov E.M., Goncharova Y.K. Mineral nutrient efficiency of rice. Russian Agricultural

Zn на фоне его критического содержания в почве был выше по сравнению с незагрязненными вариантами в 5,5 6,1 раза.
Cd 28,0 272 27,2 17,8 0,39 Pb 10,4 101 12,4 8,4 0,48 NPK Pb 24,6 239 29,0 19,2 0,47 NPK навоз Pb 28,1 273 30,4 19,9 0,43 Zn 10,5 102 13,0 8,9 0,50 NPK Zn 24,4 237 28,1 19,0 0,46 NPK навоз Zn 27,8 270 30,3 20,4 0,43 НСР05 3,2 П р и м е ч а н и е. Описание использованных фонов по вариантам опыта см. в разделе «Методика».

СО2 в атмосфере, способны положительно влиять на продуктивность пастбищ,
Полученные данные подтверждают, что система землепользования, объединяющая сообщества древесных растений с травами, способствует разнообразию и стабильности ландшафтов, рациональному использованию земель 3, 4 . Известно, что накопление СО2 и других газов, присутствующих в атмосфере в небольших количествах,

Студент спорофитное развитие микроспор происходило только в пыльниках свежеубраных колосьев,
Саратовская обл., 2006 2008 годы донорные растения первичных гекса и октаплоидных тритикале, полученных с использованием сортов озимой ржи саратовской селекции, и допущенного к использованию в Саратовской области сорта Студент. Свежеубранные колосья, пыльники которых содержали вакуолизированные микроспоры,

очистные сооружения для автомоек
ЂЂЂ до 50 мкл. Полученную смесь инкубировали в течение 1 ч при 37 С, реакцию останавливали добавлением 1 мкл 0,5 М ЭДТА. Предгибридизацию реплик гридированной библиотеки CHORI 240 Сегмент I http: bacpac.chori.org bovine240.htm проводили инкубированием при 65 С в растворе Church Buffer 0,342 М Na2HPO4,

США 1353, 1078, 872, 603, 310, 281, 271, 234, 194,
ЂЂЂ круглолистности, Волжанин ЂЂЂ кустистости и нитевидности ростков, Рубин ЂЂЂ кустистости и нитевидности ростков и в Ленинградской обл. ЂЂЂ сорта Чародей с признаками кудряша . PДНК для полимеразной цепной реакции ПЦР выделяли с помощью набора реактивов для очистки геномной ДНК в соответствии с регламентом

Государственный реестр селекционных достижений, допущенных к использованию в средней полосе
Рагулина Родничок Уэлси тетраплоидный m Бессемянка мичуринская 210 4,7 4,6 До конца августа Л.И. Дутова, Е.Н. Седов, Т.В. Рагулина, Е.В. Ульяновская, З.М. Серова, Т.Г. Причко, Л.В.Махно Юбиляр 814 Vf ЂЂЂ свободное опыление 130 4,4 4,2 До конца сентября Е.Н. Седов, З.М. Серова, В.В. Жданов, Г.А. Седышева

Достоверных сведений об образовании в этих условиях труднорастворимых лектинов крайне мало,
П р и м е ч а н и е. Приведены результаты, рассчитанные для уровня значимости Р = 0,01. Доза гербицида — 1 л га. У всех изученных сортов при обработке растений в фазу 2 листьев резко уменьшалось содержание белка, то есть происходил гидролиз белков, ускоряющийся при гербицидном стрессе. Так, у сорта

На 4 й сезон роста 2009 год все сеянцы в семьях Валентиновка x
Осиповская 23 0 0 75,0 16,7 8,3 2041 1044 20 80 x Баяна 22 0 0 28,6 42,8 28,6 2047 79 1 89 x 1439 23 139 31 0 0 22,2 22,2 55,6 2049 Орловская звезда x 1440 25 37 18 0 0 26,7 13,3 60,0 2059 Ася свободное опыление 36 20,0 30,0 50,0 0 0 2060 Нива свободное опыление 54 26,5 0 73,5 0 0 2064 Виксне свободное опыление 30 17,6 52,9 35,3 0 0 2052

профессиональные автомойки высокого давления
The first experiment showed that the using of preparations for the destruction of plant s residues leads to a gradual leveling of the soil’s conditions and to reducing of the variance of plant s heights, which were been grown on these soils. Without these preparations, the dispersion of plant s heights increases with each successive year.

Амплификацию проводили в следующем режиме: 3 мин при 94 °С далее 40 циклов:
F . graminearum в процессе селекции на повышенную устойчивость к фузариозной корневой гнили. Для сравнения межсортовых различий в анализ были включены семена сорта Диас 2. При выделении ДНК использовали набор «Diatom DNA Prep 100» ООО «Биоком», Россия . Методика выделения основана на сорбции преимущественно высокомолекулярной фракции нуклеиновых кислот на частицах сорбента,

Кандиль орловский 4 14,3±2,8 6,5 18,3 39,0 Веньяминовское 6 14,0±1,8 6,5 19,2 32,2
Выделено 73 сорта с содержанием пектиновых веществ в плодах более 12,0 табл. 1 . 1. Сорта яблони генофонда Всероссийского НИИ селекции плодовых культур с высоким содержанием пектиновых веществ в плодах в расчете на сухую массу Орловская обл., среднемноголетние данные, цит. по 13 Содержание, Сорт 12,1 13,0

Qq 15 159,00± 2,07 122,40± 0,45 23,10± 0,86 16,40± 1,11 39,90± 0,87 53,1± 1,06 qq 18 163,30± 2,36 122,50± 0,49 24,60± 0,83 17,90± 1,23 38,90± 0,86 50,7± 1,07
Q у хряков мясных пород, полученных с использованием зарубежного генофонда йоркшир, дюрок, ландрас была наибольшей 0,75 0,98 , пород белорусская крупная белая и белорусская мясная — значительно ниже 0,34 0,36 табл. 1 . 1. Частота встречаемости генотипов и аллелей гена инсулиноподобного фактора роста 2

P 0,001 compared with the varieties Mibuna and Mizuna.
Selenium content in soil and plants was determined fluorometrically using fluorimeter MPF 2A Japan 7 , the content of other micro and macroelements by atomic absorption spectrometry on the device Analyst 200 “Perkin Elmer”, USA 8 . Statistical processing of data was performed using the Student criterion.

It was established that unequal contents of fat affect digestibility of dietary nutrients.
USA particle size 100 200 mesh coated with 3 OV 225. Distillation of samples was performed during 100 min at the temperature of 180 °C the temperature of evaporator and detector  respectively, 210 and 240 °C flow of gas carrier nitrogen , hydrogen and air – respectively,  25, 60 and 300 ml min. Partial fatty acids were identified by comparing with standards “Sigma”,

 [1]  [2]  [3]  [4]  [5]  [6]