Легко и среднесуглинистые 0,200 0,178 0,96 0,100 0,037 0,87 0,080 0,024 0,64
Cs хорошо описывается совокупностью экспонент, каждая из которых аппроксимирует изменение этого показателя в определенный период времени 3 . Анализ данных, характеризующих изменение КП, показывает, что для разработки регрессионных моделей целесообразно выделить три временных периода. В течение 1 го 1987 1991 годы протекали интенсивные процессы перераспределения и фиксации 137

Интенсивность реализации рефлекса молокоотдачи во многом определяется индивидуальными особенностями коров,
Общая продолжительность доения составила в среднем 276,4 с. Резкое повышение ОСК см. рис. 1, точка D наблюдали через 68,5 с от начала доения. ОСК достигала наибольших значений через 157 с от начала доения или через 88,5 с от начала резкого подъема ОСК . Продолжительность периода повышенных значений

Seip D., Weckworth B.V., Musiani M. Survival in the
Respubliki Sakha Yakutiya na 2002 2006 gody . Utv. rasporyazheniem Prezidenta Respubliki Sakha Yakutiya ot 23 dekabrya 2002 goda № 328 RP The President Program for social and economic development of the Sakha Republic in 2002 2006. Approved by the decree of President of Sakha Republic № 328 RP of December 23,

Silencing the flavonoid pathway in Medicago truncatula inhibits root nodule formation and prevents auxin transport regulation by rhizobia.
Op den Camp H.J.M., Bouwmeester H., Kohlen W., Bisseling T., Geurts R. Rhizobium lipo chitooligosaccharide signaling triggers accumulation of cytokinins in Medicago truncatula roots. Molecular Plant , 2015, 8 8 : 1213 1226 Kisiala A., Laffont C., Emery J.R.N., Frugier F. Bioactive cytokinins are selectively secreted by

ЂЂЂ побеги соответственно 1 го, 2 го и 3 го порядка.
Краевые 9,1 9,3 11,7 14,3 Средние 8,0 6,7 9,7 11,7 Внутренние 5,0 5,0 8,3 10,0 В среднем по группе 8,1 7,0 9,9 12,0 В среднем для побегов порядка 9,3 8,6 10,8 13,9 Средние Краевые 11,5 10,8 13,2 16,3 Средние Средние 9,3 8,3 11,2 12,9 Средние Внутренние 6,9 6,7 9,0 11,4 П р и м е ч а н и е. 1, 2, 3 и 4

Брянской области и прилегающих территорий поверхностному загрязнению радионуклидами в результате аварии на
Почвы: серые и светло серые лесные легкосуглинистые, темно серые лесные, дерново подзолистые легкосуглинистые на покровных и моренных суглинках, на лессовидных суглинках, дерново подзолистые супесчаные и песчаные. Зернобобовые, фруктовые 0,6 Выгоничский То же Зернобобовые 0,5 Гордеевский Ландшафт: морено зандровые равнины с волнистым и плоским характером поверхности.

Масса яйца — один из основных показателей яичной продуктивности.
Активированный промотор заставляет экспрессироваться ген бычьего гормона роста. У трансгенных по этой конструкции перепелов происходит синтез указанного гормона, что продемонстрировано нами ранее 5, 11 . Рис. 1 . Физическая карта плазмиды pMTbGH 2 x att указаны сайты рестрикции эндонуклеазами , использованной в качестве генной конструкции при получении генетически модифицированных перепелов описание см.

Пыльца однородная, во все годы сохраняла высокую фертильность 95 100 .
РАН «Фундаментальные основы управления биологическими ресурсами» в 2003 2005 годах мы отрабатывали методы интенсивного семенного размножения ирисов в условиях открытого грунта с использованием девяти синтетических регуляторов роста — гетероауксина, крезацина, фитона, а также новых ФАВ, синтезированных в

Live weight, g абвг abcd Weight of eggs laid by transgenic quails was greater than that in control
In transgenic quails carrying this construct, the synthesis of this hormone was demonstrated previously 5, 11 . Fig . 1. Physical map of the plasmid pMTbGH 2xatt shown sites of restriction with endonucleases used as a gene construct to obtain genetically modified quail description see “Results” . Transgenic quails exceeded the control bird by live weight over the 15 studied generations

Отметим, что в принципе оба метода дают положительные результаты,
Как было показано, каллус формировался с высокой частотой при концентрации 2,4 Д в среде 3 мг л, регенерационная способность была наибольшей при концентрации 3 мг л в среде для получения и 1 мг л ЂЂЂ в среде для пассирования каллуса. Частота регенерации растений из каллусных тканей, культивируемых на средах с высоким содержанием гормонов,

RNA inhibition of starch branching enzyme activity on properties of potato starch.
Available http: www.foodmarket.spb.ru archive.php year=2016&number=155&article =2236. No date in Russ. . Jobling S. Improving starch for food and industrial applications. Curr . Opin . Plant Biol ., 2004, 7: 210 218 Comparot Moss S., Denyer K. The evolution of the starch biosynthetic pathway in cereals and other grasses.

Амилаза, ед л: до введения 3339,30a192,43 4699,00a506,30 4617,60a871,01 3779,30a514,20 3 и сут 3528,60a288,65 4595,00a571,85 4880,00a427,73 2623,60a130,67 10 е сут 3792,60a276,80 4102,30a324,37 4354,00a932,30 3610,00a185,70
Гемоглобин, г л: до введения 121,40a3,85 109,69a4,51 116,27a5,42 117,84a4,78 3 и сут 123,20a3,85 114,90a4,37 117,58a4,50 120,63a4,28 10 е сут 124,28a4,95 125,80a4,22 129,96a4,20 116,84a2,42 Число эритроцитов, m1012 л: до введения 5,29a0,14 5,32a0,34 5,56a0,41 5,08a0,14 3 и сут 5,95a0,59 5,49a0,32 6,30a0,21 5,53a0,30 10 е сут 6,47a0,39 6,10a0,34 6,29a0,32 5,33a0,22

England , 20 — Milton Canada , 21 — Eritrospermum 609
Grain formation and ripening are the processes related to creation of an offspring generation out of the photosynthesis in leaves and other green plant organs. Premature defoliation, abscission by leaf eating insects, fungal diseases or experimental artificial deletion contribute to a stress and change in a quantitative relationship between producing plant organs and ones consuming assimilates,

The peak of pyruvate content shifted relative to control from 3,5 h to 7 h of incubation.
Concentration of hexoses, umol cm 3 The content of pyruvic acid was established upon its ability to form 2,4 dinitrophenylhydrazones, which were purified by reverse extraction from toluene solution into an aqueous solution of soda Na 2 CO 3 and transferred to the aci form by adding sodium hydroxide solution 8 .

По количеству незаменимых аминокислот значительных различий с контролем не отмечали.
Птицу выращивали без разделения по полу с соблюдением технологических условий содержания, кормили вволю сухими полнорационными кормами по нормам питательной ценности, рекомендованным для указанного кросса 8 . В корм птицы из опытной группы добавляли исследуемый нанокомплекс в дозе 30 г т. Кормовые антибиотики не использовали.

It can be expected that such differences are the result of natural selection for high resistance to unfavorable environmental factors.
To prepare the smears,  a drop of peripheral blood was mixed on a slide with a drop of saline, evenly distributed on surface, dried, fixed with methanol for 30 min and stained with Giemsa dye “Merk”, Germany . The number of erythrocytes with micronuclei was determined in 3000 cells and calculated to 1000 cells ‰ .

Нейтрофилы, 63,50±6,70 62,60±1,50 67,90±1,52 69,30±4,70 65,10±3,50 65,40±6,24 60,80±9,20 68,80±9,07
Содержание гемоглобина у молодняка норок также находилось в пределах физиологической нормы от 150,2±11,3 до 156,3±24,1 г л , к концу опыта наблюдалась тенденция к увеличению этого показателя. К окончанию эксперимента во всех опытных группах возрастало число тромбоцитов наиболее значительно — у особей из

ПДК для плодов и ягод 14 0,400 0,500 10,000 5,000 50,000
Поступление микроэлементов в растения может быть пассивным по градиенту концентрации или активным против градиента концентрации с затратой энергии , что предполагает существование двух главных факторов формирования элементного химического состава растений — генетического и экологического. Доля каждого варьирует в зависимости от изменений условий среды.

Все испытанные мембраны, обладая 100 селективностью по белку,
Эффективность мембран оценивали по кратности концентрирования препарата измеряя объем фильтрата в мерном сосуде на выходе из ультрафильтрационной установки , величине и стабильности биологической активности вируса в концентрате ВСМ, степени очистки материала по белку, скорости фильтрации, селективности и технологичности.

Atoll A-460E A-550 MAX
Во всех хозяйствах на протяжении периода наблюдений качество потребляемых животными кормов в основном соответствовало II IV классу, то есть оказалось ниже требуемого. Практически повсеместно тип кормления был сено силосно концентратным, в рационах регистрировали недостаток сырого протеина и каротина,

По нашему мнению, это связано с проявлением защитных свойств плаценты на ранней стадии внутриутробного развития.
Кровь, мкг мл 0,16± 0,14 0,64± 0,13 0,85± 0,11 1,07± 0,37 1,56± 0,38 1,36± 0,27 0,89± 0,13 1,08± 0,21 0,96± 0,18 Плацента, мкг г 0,98± 0,12 0,63± 0,11 0,58± 0,14 0,28± 0,09 0,52± 0,15 0,64± 0,12 0,55± 0,18 0,41± 0,04 0,35± 0,11 Предплоды плоды Мышечная ткань, мкг г 0,29± 0,10 0,84± 9,21 0,76± 0,07 0,05± 0,45 1,39± 0,37 1,27± 0,25 1,05± 0,25 1,07± 0,12

Как известно, в условиях постоянно варьирующих факторов внешней среды и конкурентных взаимоотношений всегда наблюдается та или иная степень изменчивости внутри сорта как результат морфофизиологических приспособительных реакций 9 11 ,
В начале вегетации в фазу всходов посев по параметрам площади листовой поверхности и сухой массе был однороден и характеризовался относительно невысокими средними значениями показателей табл. 1 . 1. Средние значения Х ± х , стандартное отклонение d и коэффициент вариации Cv морфологических показателей у растений яровой пшеницы сорта

По числу колосков в мутовке у овса посевного размах варьирования был выше,
США 2,4±0,1 2,7±0,1 4,2±0,1 12,9 16,4 9,2 3,3±0,2 2,9±0,2 4,6±0,2 5,1±0,3 15,6 17,7 16,6 17,9 веточек общее 5419 4877 14762 11714 Турция Турция США США 15,1±8,0 29,0±0,9 16,9 10,5 20,0±2,2 14,8±1,5 30,3±1,6 33,6±1,6 31,7 32,9 16,2 14,0 колосков в мутовке 4763 4742 12216 10509 Алжир Алжир Индия Индия 21,9±1,6 79,5±4,3 22,8 17,0 37,8±4,7 21,3±2,1 49,2±11,8 84,1±5,5 39,7 30,1 72,0 20,6 зерен в метелке 11404 4742 13906 7936

VI 70,00±4,15 75,46±1,53 8,39±0,19 VII 71,25±5,61 76,40±1,90 8,45±0,33 20 е   с у т   п о с л е   о п о р о с а
Р 0,05 у лактирующих особей — на 7,70 14,70 Р 0,05 и 17,90 Р 0,05 см. рис. . Содержание иммуноглобулинов в сыворотке крови свиноматок в разные сроки супоросности и лактации в зависимости от количества аскорбиновой кислоты А и свекловичной патоки Б в рационах: а, б, в, г, д, е, ж — соответственно I контроль ,

насос трехплунжерный типа нк
Комбикорма содержали 10 подсолнечного шрота до 21 х сут выращивания и 20 — с 22 х сут до убоя 37 е сут . Учитывали сохранность поголовья, живую массу бройлеров в возрасте 1, 21 и 37 сут, потребление корма за период выращивания в расчете на 1 гол., затраты корма на 1 кг прироста живой массы на окончание опыта ,

До облучения контроль 2,23±0,21 2,18±0,13 2,18±0,13
Са 2 в тромбоцитах и лимфоцитах необлученных овец показало, что его значения составляли в среднем соответственно 2,42±0,25 и 2,33±0,31 мкг мг белка. После внешнего &gamma облучения овец общее содержание Са 2 в тромбоцитах практически не отличалось от исходного независимо от срока исследования и дозы воздействия табл.

Московского зоопарка Волоколамский р н, Московская обл.
Площадь гнездовой камеры в берлоге составляла около 2 м 2 . Сверху берлоги делали земляную насыпь высотой 1,5 м. В убежище устанавливали видеокамеру и электротермометр, с помощью которого измеряли температуру воздуха в норе и снаружи. Видеоинформация круглосуточно регистрировалась компьютером, расположенным в помещении,

А в сыворотке крови телят, которые получали молозиво в 1 е сут жизни,
II молозиво С в о б о д н о р а д и к а л ь н о е о к и с л е н и е л и п и д о в Через 1 сут ДК, OП 232 мг липидов 0,220±0,0105 0,244±0,0210 МДА, мкмоль л 1,34±0,187 1,96±0,141 Через 2 сут ДК, ОП 232 мг липидов 0,210±0,0124 0,254±0,0320 МДА, мкмоль л 0,99±0,050 1,75±0,025 Через 3 сут ДК, ОП 232 мг липидов 0,212±0,0112 0,240±0,0143

Среднее 7 9 4,30±0,33 39,00±1,52 56,70±1,76 10 32 3,00±0,44 39,00±1,64 58,00±0,73 11 32 4,00±0,46 39,00±0,92 57,00±0,89 12 32 3,00±0,66 42,00±1,23 55,00±1,32
Альфа ритм частота 8 12 кол с, амплитуда 20 60 мкВ см. рис., в наблюдали у животных в спокойном бодрствующем состоянии, реже в состоянии активного бодрствования. Для амплитуды альфа ритма характерна модуляция, запись имеет вид веретена, типичного только для альфа ритма: сначала отмечается волна с низкой амплитудой,

В среднем за 3 года при использовании микробных препаратов происходило увеличение числа активных клубеньков на корнях гороха в 1,2 1,6 раза с одновременным ростом его урожайности на 19 25 ,
Урожайность гороха посевного сорта Татьяна при использовании микробиологических препаратов и минеральных удобрений Орловская обл., 2003 2005 годы Вариант Урожайность, т га Прибавка к контролю, Контроль 2,15 Бисолбисан 2,67 24,2 Бисолбимикс 2,89 34,4 N 22,5 P 30 K 45 2,66 23,7 N 22,5 P 30 K 45 бисолбисан 2,80 30,2

Enhanced Avian Reverse Transcriptase PCR Kit «Sigma
Catctctggctgggttcttc 3&prime rv 5&prime Aattgcttcggaaccacaag 3&prime 59 115 XM 420348 fw 5&prime gagctgccaaaaactgcttc 3&prime rv 5&prime agatcagcctcttgcaccat 3&prime 59 142 NM 001031126 fw 5&prime gcagcagaaagagcagagg 3&prime rv 5&prime tcgttagcctcagtccacct 3&prime 59 103 XM 420350 fw 5&prime Aacgacctggagaagcagaa 3&prime rv 5&prime

Koltai eds. . Springer, NY, 2010 Hanlon M.T., Coenen
AM efficiency by weight for aboveground parts, and, therefore, a shift in IAA concentration significantly intensified development of the aboveground parts at the shooting and flowering. Keywords: auxin, indolilacetic acid, arbuscular mycorrhiza, symbiotic efficiency, Rhizophagus irregularis , Medicago lupulina.

Cloning , 2000, 2: 79 90 Loi P., Modlinski J.A., Ptak
Oxford University Press, Oxford, UK, 2006. Martinsen G.D., Whitham T.G., Turek R.J., Keim P. Hybrid populations selectively filter gene introgression between species. Evolution , 2001, 55 7 : 1325 1335 Schwenk K., Brede N., Streit B. Introduction. Extent, processes and evolutionary impact of interspecific hybridization in animals.

Измайловского парка превышало минимальное 4 мг кг более чем в 60,0 раза.
Для абсорбции ртути внутренняя поверхность графитовой печи атомизатора спектрометра предварительно покрывается слоем высокодисперсного палладия. Результаты . Вода из трех водоемов, на которых были отловлены утки, существенно различалась по содержанию поллютантов табл. 1 . Наибольшим содержанием Pb характеризовались водоемы

индивидуальный инструктор
Содержание в молозиве после отела в молоке через 24 ч на 3 4 е сут на 5 6 е сут г 100 мл г 100 мл г 100 мл г 100 мл Об щий 14,421±0,041 100 5,193±0,096 100 3,387±0,047 100 3,328±0,053 100 Казе ины: 2,755±0,046 19,1 2,671±0,051 51,4 2,664±0,048 78,7 2,613±0,044 78,5 F 0,044±0,004 0,3 0,043±0,004 0,8 0,046±0,004 1,4 0,048±0,008 1,4 &alpha s´ 0,135±0,009 0,9 0,124±0,010 2,4 0,128±0,010 3,8 0,117±0,015 3,5 &alpha s 0 0,201±0,009 1,4 0,183±0,011 3,5 0,203±0,013 6,0 0,189±0,006 5,7 &alpha s 1 0,891±0,025 6,2 0,898±0,029 17,3 0,883±0,022 26,1 0,844±0,022 25,4 &alpha s 2 0,280±0,019 1,9 0,290±0,020 5,6 0,274±0,015 8,1 0,230±0,009 6,9 &beta 0,777±0,019 5,4 0,733±0,025 14,1 0,714±0,024 21,1 0,796±0,018 23,9 &kappa 0,230±0,011 1,6 0,230±0,011 4,4 0,228±0,013 6,7 0,232±0,010 7,0 &gamma 0,111±0,009 0,8 0,091±0,006 1,8 0,099±0,008 2,9 0,076±0,004 2,3 s 0,087±0,008 0,6 0,079±0,005 1,5 0,089±0,006 2,6 0,081±0,007 2,4

Хуштада 257±16 127±21 8,6 8,6 Среднее 304±52 202±49 9,9
Кроме того, провели сравнительную оценку содержания селена в яйцах у несушек на птицефабриках ПФ , использующих селенит натрия, — ООО «Краснодарская ПФ», ПФ «Новороссийская», ООО «Магнитогорский птицеводческий комплекс», ОАО «Кондопожская ПФ», ЗАО ПФ «Роскар» Ленинградская обл. , ОНО «Загорское ЭПХ

Ростовской области степень загрязнения зерна кукурузы фузариотоксинами оставалась столь же значительной 34 образца из 36 .
Ю ж н ы й ф е д е р а л ь н ы й о к р у г 2002 год 51 47 47 9 — — 37 — — — 10 — — — — — — 2003 год 38 34 34 6 2 4 27 — — — 2 — 1 — 3 — 1 2004 2005 годы 36 34 31 19 7 — 12 3 — — 12 — 3 — — 4 — З е р н о р и с а К р а с н о д а р с к и й к р а й 2002 год 15 12 2 12 — — — 10 — — 2 — — — — — — 2003 год 7 6 4 6 1 4 — 1 — — 1 — — 1 2 — 1

L — расстояние между опорами, на которых расположена исследуемая кость
У собак под общей анестезией провели остеотомию правой большеберцовой кости под углом 12° к длинной оси косой перелом и иммобилизировали отломки посредством двух циркулярно наложенных на диафиз кости стягивающих полос авторской конструкции 7 левая большеберцовая кость служила контролем . После операции животным был назначен курс общей послеоперационной терапии,

Dairy Sci ., 2015, 98: 4969 4989 Pryce J.E., Bolormaa
Genetic labeling, conservation of biodiversity and the problems in animals breeding . Sel ’ skokhozyaistvennaya Biologiya Agricultural Biology , 2011, 2: 3 14 in Russ. . Stolpovskii Yu.A. Kontseptsiya i printsipy geneticheskogo monitoringa dlya sokhraneniya in situ porod domestitsirovannykh zhivotnykh

очистные сооружения для автомоек
Статистическую обработку результатов исследований проводили с использованием стандартного пакета программ «Анализ данных» в системе Microsoft Exсel 7.0 for Windows 98. Обрабатывали показатели 10 животных остальные по разным причинам были выбракованы . Результаты. У новорожденных телочек в крови отмечали пониженное число лейкоцитов и лимфоцитов,

ОСК перед доением по величине разового удоя половины вымени
Объем крови в расчете на 1 л молока, л 1 2 11 я 2,74±0,09 2,85±0,08 682±17 2 2 27 я 2,92±0,07 2,82±0,09 740±20 5 5 13 я 2,70±0,06 3,06±0,17 634±36 6 4 20 я 4,32±0,10 4,20±0,24 751±37 7 4 17 я 2,97±0,16 3,06±0,06 723±40 11 4 18 я 3,45±0,12 4,06±0,12 622±31 12 3 9 я 2,40±0,10 3,09±0,11 549±23 13 2 17 я 2,52±0,14 2,95±0,05 628±20 14 2 27 я 1,93±0,03 1,70±0,12 830±72

Spain. Reprod. Domest. Anim ., 2008, 43: 38 43 Seifi
The changes in immune status of mother cows with embryonic mortality manifested themselves by an increase in the number of blood leukocytes, their neutrophilic and eosinophilic forms, monocytes, by a decrease in phagocytic activity, the number of lymphocytes, immunoglobulins, bactericidal activity and lysozyme activity in blood serum,

Inheritance of physiological nitrogen use efficiency and relationship among its associated charaters in rice.
Kubanskogo gosudarstvennogo agrarnogo universiteta , 2010: 54 58 in Russ. . Goncharova Yu.K. Inheritance of determinants specific for physiological heterosis basis in rice hybrids. Agricultural Biology , 2010, 5: 72 78. Kharitonov E.M., Goncharova Y.K. Mineral nutrient efficiency of rice. Russian Agricultural

Structure and reaction mechanism of D amino acid oxidase.
Progress in Physiology , 2008, 39 1 : 64 66 PMID: 18357693 . Saitoh Y., Katane M., Kawata T., Maeda K., Sekine M., Furuchi T., Kobuna H., Sakamoto T., Inoue T., Arai H., Nakagawa Y., Homma H. Spatiotemporal localization of D amino acid oxidase and D aspartate oxidases during development in Caenorhabditis elegans.

профессиональные автомойки высокого давления
Franke P., Vater J., Borriss R. Structural and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic lipopeptides in Bacillus amyloliquefaciens strain FZB42. J. Bacteriol ., 2004, 186 4 : 1084 1096 Azevedo J.L., Maccheroni J. Jr., Pereira O., Ara W.L. Endophytic microorganisms:

II группе: по сравнению с контролем достоверно повышалась переваримость сухого вещества — на 3,13 4,21
Разгонку проб выполняли в течение 100 мин при температуре 180 °С температура испарителя и детектора — соответственно 210 и 240 °С расход газоносителя азота , водорода и воздуха — соответственно 25 60 и 300 мл мин. Разделяемые жирные кислоты идентифицировали, сравнивая со стандартами «Sigma», США , обработку хроматограмм осуществляли по методике,

Zn на фоне его критического содержания в почве был выше по сравнению с незагрязненными вариантами в 5,5 6,1 раза.
Cd 28,0 272 27,2 17,8 0,39 Pb 10,4 101 12,4 8,4 0,48 NPK Pb 24,6 239 29,0 19,2 0,47 NPK навоз Pb 28,1 273 30,4 19,9 0,43 Zn 10,5 102 13,0 8,9 0,50 NPK Zn 24,4 237 28,1 19,0 0,46 NPK навоз Zn 27,8 270 30,3 20,4 0,43 НСР05 3,2 П р и м е ч а н и е. Описание использованных фонов по вариантам опыта см. в разделе «Методика».

СО2 в атмосфере, способны положительно влиять на продуктивность пастбищ,
Полученные данные подтверждают, что система землепользования, объединяющая сообщества древесных растений с травами, способствует разнообразию и стабильности ландшафтов, рациональному использованию земель 3, 4 . Известно, что накопление СО2 и других газов, присутствующих в атмосфере в небольших количествах,

Студент спорофитное развитие микроспор происходило только в пыльниках свежеубраных колосьев,
Саратовская обл., 2006 2008 годы донорные растения первичных гекса и октаплоидных тритикале, полученных с использованием сортов озимой ржи саратовской селекции, и допущенного к использованию в Саратовской области сорта Студент. Свежеубранные колосья, пыльники которых содержали вакуолизированные микроспоры,

США 1353, 1078, 872, 603, 310, 281, 271, 234, 194,
ЂЂЂ круглолистности, Волжанин ЂЂЂ кустистости и нитевидности ростков, Рубин ЂЂЂ кустистости и нитевидности ростков и в Ленинградской обл. ЂЂЂ сорта Чародей с признаками кудряша . PДНК для полимеразной цепной реакции ПЦР выделяли с помощью набора реактивов для очистки геномной ДНК в соответствии с регламентом

 [1]  [2]  [3]  [4]  [5]  [6]